Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 7479489
total bases: 1129402839
Q20 bases: 1091563151(96.6496%)
Q30 bases: 1038945338(91.9907%)

Read2 before filtering:
total reads: 7479489
total bases: 1129402839
Q20 bases: 1096711565(97.1054%)
Q30 bases: 1034946702(91.6366%)

Read1 after filtering:
total reads: 7383040
total bases: 921954866
Q20 bases: 914752505(99.2188%)
Q30 bases: 887690276(96.2835%)

Read2 after filtering:
total reads: 7383040
total bases: 922831227
Q20 bases: 914509692(99.0983%)
Q30 bases: 888757558(96.3077%)

Filtering result:
reads passed filter: 14766080
reads failed due to low quality: 174472
reads failed due to too many N: 15058
reads failed due to too short: 3368
reads with adapter trimmed: 8542795
bases trimmed due to adapters: 387453663

Duplication rate: 17.1967%

Insert size peak (evaluated by paired-end reads): 103

JSON report: dna_s739.fastp.json
HTML report: dna_s739.fastp.html

fastp --in1 dna_s739_1.fastq.gz --in2 dna_s739_2.fastq.gz --out1 dna_s739_1.fastp.fastq.gz --out2 dna_s739_2.fastp.fastq.gz --json dna_s739.fastp.json --html dna_s739.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 45 seconds