Detecting adapter sequence for read1...
>Nextera_LMP_Read1_External_Adapter | >Illumina Multiplexing Index Sequencing Primer
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 70035
total bases: 10575285
Q20 bases: 10330408(97.6844%)
Q30 bases: 9779489(92.4749%)

Read2 before filtering:
total reads: 70035
total bases: 10575285
Q20 bases: 9338783(88.3076%)
Q30 bases: 7968082(75.3463%)

Read1 after filtering:
total reads: 54629
total bases: 7884786
Q20 bases: 7819224(99.1685%)
Q30 bases: 7551298(95.7705%)

Read2 after filtering:
total reads: 54629
total bases: 7979250
Q20 bases: 7750080(97.1279%)
Q30 bases: 7162340(89.7621%)

Filtering result:
reads passed filter: 109258
reads failed due to low quality: 21780
reads failed due to too many N: 162
reads failed due to too short: 8870
reads with adapter trimmed: 24449
bases trimmed due to adapters: 1497918

Duplication rate: 8.4315%

Insert size peak (evaluated by paired-end reads): 174

JSON report: dna_s778.fastp.json
HTML report: dna_s778.fastp.html

fastp --in1 dna_s778_1.fastq.gz --in2 dna_s778_2.fastq.gz --out1 dna_s778_1.fastp.fastq.gz --out2 dna_s778_2.fastp.fastq.gz --json dna_s778.fastp.json --html dna_s778.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 2 seconds