Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 20805724
total bases: 3141664324
Q20 bases: 3087351027(98.2712%)
Q30 bases: 2970711194(94.5585%)

Read2 before filtering:
total reads: 20805724
total bases: 3141664324
Q20 bases: 3073176519(97.82%)
Q30 bases: 2929422640(93.2443%)

Read1 after filtering:
total reads: 20518494
total bases: 2719630348
Q20 bases: 2703034494(99.3898%)
Q30 bases: 2628497935(96.6491%)

Read2 after filtering:
total reads: 20518494
total bases: 2723012580
Q20 bases: 2700939117(99.1894%)
Q30 bases: 2623938708(96.3616%)

Filtering result:
reads passed filter: 41036988
reads failed due to low quality: 456540
reads failed due to too many N: 4498
reads failed due to too short: 113422
reads with adapter trimmed: 22815794
bases trimmed due to adapters: 761096974

Duplication rate: 28.3176%

Insert size peak (evaluated by paired-end reads): 140

JSON report: 659_beZ_T1_TRNA_2_B2372Y3LT4_1.fastp.json
HTML report: 659_beZ_T1_TRNA_2_B2372Y3LT4_1.fastp.html

fastp --in1 659_beZ_T1_TRNA_2_B2372Y3LT4_1_1.fastq.gz --in2 659_beZ_T1_TRNA_2_B2372Y3LT4_1_2.fastq.gz --out1 659_beZ_T1_TRNA_2_B2372Y3LT4_1_1.fastp.fastq.gz --out2 659_beZ_T1_TRNA_2_B2372Y3LT4_1_2.fastp.fastq.gz --json 659_beZ_T1_TRNA_2_B2372Y3LT4_1.fastp.json --html 659_beZ_T1_TRNA_2_B2372Y3LT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 86 seconds