File Info

Filename
dna_s743.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/cgp_rna_exp0034/B2372Y3LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/dna_s743.fastp.log
Size
1.4 KB
Published
Jun 08, 2026 12:12 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 41147996
total bases: 6213347396
Q20 bases: 6078914532(97.8364%)
Q30 bases: 5841646947(94.0177%)

Read2 before filtering:
total reads: 41147996
total bases: 6213347396
Q20 bases: 6079673446(97.8486%)
Q30 bases: 5805863942(93.4418%)

Read1 after filtering:
total reads: 40838773
total bases: 5420357332
Q20 bases: 5379085073(99.2386%)
Q30 bases: 5224589446(96.3883%)

Read2 after filtering:
total reads: 40838773
total bases: 5421295260
Q20 bases: 5379866037(99.2358%)
Q30 bases: 5246475171(96.7753%)

Filtering result:
reads passed filter: 81677546
reads failed due to low quality: 522348
reads failed due to too many N: 94818
reads failed due to too short: 1280
reads with adapter trimmed: 37921681
bases trimmed due to adapters: 1497494397

Duplication rate: 22.8689%

Insert size peak (evaluated by paired-end reads): 116

JSON report: dna_s743.fastp.json
HTML report: dna_s743.fastp.html

fastp --in1 dna_s743_1.fastq.gz --in2 dna_s743_2.fastq.gz --out1 dna_s743_1.fastp.fastq.gz --out2 dna_s743_2.fastp.fastq.gz --json dna_s743.fastp.json --html dna_s743.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 91 seconds