File Info

Filename
dna_s713.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/cgp_rna_exp0034/B2372Y3LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/dna_s713.fastp.log
Size
1.4 KB
Published
Jun 08, 2026 1:00 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44679058907(98.6293%)
Q30 bases: 43024137705(94.976%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44479770921(98.1893%)
Q30 bases: 42625776243(94.0966%)

Read1 after filtering:
total reads: 296896574
total bases: 41464376395
Q20 bases: 41167523483(99.2841%)
Q30 bases: 39910042407(96.2514%)

Read2 after filtering:
total reads: 296896574
total bases: 41476954120
Q20 bases: 41139520921(99.1865%)
Q30 bases: 39946440758(96.31%)

Filtering result:
reads passed filter: 593793148
reads failed due to low quality: 6043470
reads failed due to too many N: 73498
reads failed due to too short: 89884
reads with adapter trimmed: 191831273
bases trimmed due to adapters: 6759952047

Duplication rate: 25.3067%

Insert size peak (evaluated by paired-end reads): 134

JSON report: dna_s713.fastp.json
HTML report: dna_s713.fastp.html

fastp --in1 dna_s713_1.fastq.gz --in2 dna_s713_2.fastq.gz --out1 dna_s713_1.fastp.fastq.gz --out2 dna_s713_2.fastp.fastq.gz --json dna_s713.fastp.json --html dna_s713.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1027 seconds