File Info

Filename
dna_s712.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/cgp_rna_exp0034/B2372Y3LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/dna_s712.fastp.log
Size
1.4 KB
Published
Jun 08, 2026 1:00 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44682792890(98.6375%)
Q30 bases: 43107987413(95.1611%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44589476610(98.4315%)
Q30 bases: 42814788753(94.5139%)

Read1 after filtering:
total reads: 297750531
total bases: 42031113565
Q20 bases: 41743802380(99.3164%)
Q30 bases: 40492937761(96.3404%)

Read2 after filtering:
total reads: 297750531
total bases: 42034585767
Q20 bases: 41689425224(99.1789%)
Q30 bases: 40443378751(96.2145%)

Filtering result:
reads passed filter: 595501062
reads failed due to low quality: 4415860
reads failed due to too many N: 74444
reads failed due to too short: 8634
reads with adapter trimmed: 169792332
bases trimmed due to adapters: 5878231483

Duplication rate: 19.3253%

Insert size peak (evaluated by paired-end reads): 142

JSON report: dna_s712.fastp.json
HTML report: dna_s712.fastp.html

fastp --in1 dna_s712_1.fastq.gz --in2 dna_s712_2.fastq.gz --out1 dna_s712_1.fastp.fastq.gz --out2 dna_s712_2.fastp.fastq.gz --json dna_s712.fastp.json --html dna_s712.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 998 seconds