File Info

Filename
dna_s715.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/cgp_rna_exp0034/B2372Y3LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/dna_s715.fastp.log
Size
1.4 KB
Published
Jun 08, 2026 1:00 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44674294629(98.6188%)
Q30 bases: 43036291676(95.0029%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44577940341(98.406%)
Q30 bases: 42841674249(94.5732%)

Read1 after filtering:
total reads: 297585189
total bases: 41874412477
Q20 bases: 41576035042(99.2874%)
Q30 bases: 40305488330(96.2533%)

Read2 after filtering:
total reads: 297585189
total bases: 41879161555
Q20 bases: 41550779265(99.2159%)
Q30 bases: 40362313612(96.378%)

Filtering result:
reads passed filter: 595170378
reads failed due to low quality: 4722940
reads failed due to too many N: 71868
reads failed due to too short: 34814
reads with adapter trimmed: 179007824
bases trimmed due to adapters: 6145589417

Duplication rate: 18.6398%

Insert size peak (evaluated by paired-end reads): 139

JSON report: dna_s715.fastp.json
HTML report: dna_s715.fastp.html

fastp --in1 dna_s715_1.fastq.gz --in2 dna_s715_2.fastq.gz --out1 dna_s715_1.fastp.fastq.gz --out2 dna_s715_2.fastp.fastq.gz --json dna_s715.fastp.json --html dna_s715.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1014 seconds