File Info

Filename
dna_s717.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/cgp_rna_exp0034/B2372Y3LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/dna_s717.fastp.log
Size
1.4 KB
Published
Jun 08, 2026 1:00 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44617093742(98.4925%)
Q30 bases: 42999413667(94.9214%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44512952192(98.2626%)
Q30 bases: 42695078611(94.2496%)

Read1 after filtering:
total reads: 297628769
total bases: 41362227198
Q20 bases: 41073767656(99.3026%)
Q30 bases: 39858072761(96.3635%)

Read2 after filtering:
total reads: 297628769
total bases: 41368159218
Q20 bases: 41045649172(99.2204%)
Q30 bases: 39891708989(96.431%)

Filtering result:
reads passed filter: 595257538
reads failed due to low quality: 4663972
reads failed due to too many N: 74642
reads failed due to too short: 3848
reads with adapter trimmed: 199793240
bases trimmed due to adapters: 7183302208

Duplication rate: 26.6922%

Insert size peak (evaluated by paired-end reads): 133

JSON report: dna_s717.fastp.json
HTML report: dna_s717.fastp.html

fastp --in1 dna_s717_1.fastq.gz --in2 dna_s717_2.fastq.gz --out1 dna_s717_1.fastp.fastq.gz --out2 dna_s717_2.fastp.fastq.gz --json dna_s717.fastp.json --html dna_s717.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1018 seconds