File Info

Filename
dna_s720.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/cgp_rna_exp0034/B2372Y3LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/dna_s720.fastp.log
Size
1.4 KB
Published
Jun 08, 2026 1:00 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44679403076(98.63%)
Q30 bases: 43073591895(95.0852%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44567168801(98.3823%)
Q30 bases: 42745915606(94.3618%)

Read1 after filtering:
total reads: 297858865
total bases: 41980026878
Q20 bases: 41684940170(99.2971%)
Q30 bases: 40403173374(96.2438%)

Read2 after filtering:
total reads: 297858865
total bases: 41983619230
Q20 bases: 41639280602(99.1798%)
Q30 bases: 40392205463(96.2094%)

Filtering result:
reads passed filter: 595717730
reads failed due to low quality: 4205546
reads failed due to too many N: 74962
reads failed due to too short: 1762
reads with adapter trimmed: 175290744
bases trimmed due to adapters: 6014146232

Duplication rate: 19.1791%

Insert size peak (evaluated by paired-end reads): 140

JSON report: dna_s720.fastp.json
HTML report: dna_s720.fastp.html

fastp --in1 dna_s720_1.fastq.gz --in2 dna_s720_2.fastq.gz --out1 dna_s720_1.fastp.fastq.gz --out2 dna_s720_2.fastp.fastq.gz --json dna_s720.fastp.json --html dna_s720.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1049 seconds