File Info

Filename
dna_s719.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/cgp_rna_exp0034/B2372Y3LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/dna_s719.fastp.log
Size
1.4 KB
Published
Jun 08, 2026 1:00 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44629049117(98.5189%)
Q30 bases: 43029055668(94.9869%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44571393661(98.3916%)
Q30 bases: 42790465541(94.4602%)

Read1 after filtering:
total reads: 297891429
total bases: 41623282007
Q20 bases: 41329141307(99.2933%)
Q30 bases: 40091918015(96.3209%)

Read2 after filtering:
total reads: 297891429
total bases: 41626990913
Q20 bases: 41304060888(99.2242%)
Q30 bases: 40139304736(96.4262%)

Filtering result:
reads passed filter: 595782858
reads failed due to low quality: 4144692
reads failed due to too many N: 70884
reads failed due to too short: 1566
reads with adapter trimmed: 194385176
bases trimmed due to adapters: 6739507025

Duplication rate: 19.0402%

Insert size peak (evaluated by paired-end reads): 137

JSON report: dna_s719.fastp.json
HTML report: dna_s719.fastp.html

fastp --in1 dna_s719_1.fastq.gz --in2 dna_s719_2.fastq.gz --out1 dna_s719_1.fastp.fastq.gz --out2 dna_s719_2.fastp.fastq.gz --json dna_s719.fastp.json --html dna_s719.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 998 seconds