File Info

Filename
dna_s725.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/cgp_rna_exp0034/B2372Y3LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/dna_s725.fastp.log
Size
1.4 KB
Published
Jun 08, 2026 1:03 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44720268632(98.7202%)
Q30 bases: 43130817418(95.2115%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44571569654(98.392%)
Q30 bases: 42755373446(94.3827%)

Read1 after filtering:
total reads: 297918739
total bases: 41908531231
Q20 bases: 41625287354(99.3241%)
Q30 bases: 40378858700(96.35%)

Read2 after filtering:
total reads: 297918739
total bases: 41912059391
Q20 bases: 41581288763(99.2108%)
Q30 bases: 40378474058(96.3409%)

Filtering result:
reads passed filter: 595837478
reads failed due to low quality: 4086380
reads failed due to too many N: 70516
reads failed due to too short: 5626
reads with adapter trimmed: 178710017
bases trimmed due to adapters: 6174001801

Duplication rate: 18.853%

Insert size peak (evaluated by paired-end reads): 137

JSON report: dna_s725.fastp.json
HTML report: dna_s725.fastp.html

fastp --in1 dna_s725_1.fastq.gz --in2 dna_s725_2.fastq.gz --out1 dna_s725_1.fastp.fastq.gz --out2 dna_s725_2.fastp.fastq.gz --json dna_s725.fastp.json --html dna_s725.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1013 seconds