File Info

Filename
dna_s721.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/cgp_rna_exp0034/B2372Y3LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/dna_s721.fastp.log
Size
1.4 KB
Published
Jun 08, 2026 1:03 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44572951102(98.395%)
Q30 bases: 42900503832(94.7031%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44503430932(98.2416%)
Q30 bases: 42661535334(94.1756%)

Read1 after filtering:
total reads: 297189955
total bases: 41282813990
Q20 bases: 40978880238(99.2638%)
Q30 bases: 39707624849(96.1844%)

Read2 after filtering:
total reads: 297189955
total bases: 41289909597
Q20 bases: 40965803526(99.215%)
Q30 bases: 39799911415(96.3914%)

Filtering result:
reads passed filter: 594379910
reads failed due to low quality: 5537098
reads failed due to too many N: 71352
reads failed due to too short: 11640
reads with adapter trimmed: 202713379
bases trimmed due to adapters: 7215962117

Duplication rate: 26.0009%

Insert size peak (evaluated by paired-end reads): 132

JSON report: dna_s721.fastp.json
HTML report: dna_s721.fastp.html

fastp --in1 dna_s721_1.fastq.gz --in2 dna_s721_2.fastq.gz --out1 dna_s721_1.fastp.fastq.gz --out2 dna_s721_2.fastp.fastq.gz --json dna_s721.fastp.json --html dna_s721.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1006 seconds