File Info

Filename
dna_s726.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/cgp_rna_exp0034/B2372Y3LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/dna_s726.fastp.log
Size
1.4 KB
Published
Jun 08, 2026 1:03 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44617640479(98.4937%)
Q30 bases: 42984873131(94.8893%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44500211418(98.2345%)
Q30 bases: 42669610779(94.1934%)

Read1 after filtering:
total reads: 296872373
total bases: 41547899532
Q20 bases: 41254961130(99.2949%)
Q30 bases: 39987065230(96.2433%)

Read2 after filtering:
total reads: 296872373
total bases: 41560659390
Q20 bases: 41224650255(99.1915%)
Q30 bases: 40021248791(96.296%)

Filtering result:
reads passed filter: 593744746
reads failed due to low quality: 6130070
reads failed due to too many N: 71054
reads failed due to too short: 54130
reads with adapter trimmed: 186233930
bases trimmed due to adapters: 6585888624

Duplication rate: 25.9456%

Insert size peak (evaluated by paired-end reads): 137

JSON report: dna_s726.fastp.json
HTML report: dna_s726.fastp.html

fastp --in1 dna_s726_1.fastq.gz --in2 dna_s726_2.fastq.gz --out1 dna_s726_1.fastp.fastq.gz --out2 dna_s726_2.fastp.fastq.gz --json dna_s726.fastp.json --html dna_s726.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 967 seconds