File Info

Filename
dna_s730.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/cgp_rna_exp0034/B2372Y3LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/dna_s730.fastp.log
Size
1.4 KB
Published
Jun 08, 2026 1:03 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44694640104(98.6637%)
Q30 bases: 43109619802(95.1647%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44582010561(98.415%)
Q30 bases: 42819685804(94.5247%)

Read1 after filtering:
total reads: 297670814
total bases: 41678473305
Q20 bases: 41390404704(99.3088%)
Q30 bases: 40167158024(96.3739%)

Read2 after filtering:
total reads: 297670814
total bases: 41683383308
Q20 bases: 41359793234(99.2237%)
Q30 bases: 40194039838(96.427%)

Filtering result:
reads passed filter: 595341628
reads failed due to low quality: 4563964
reads failed due to too many N: 72560
reads failed due to too short: 21848
reads with adapter trimmed: 192171381
bases trimmed due to adapters: 6563246099

Duplication rate: 18.1749%

Insert size peak (evaluated by paired-end reads): 135

JSON report: dna_s730.fastp.json
HTML report: dna_s730.fastp.html

fastp --in1 dna_s730_1.fastq.gz --in2 dna_s730_2.fastq.gz --out1 dna_s730_1.fastp.fastq.gz --out2 dna_s730_2.fastp.fastq.gz --json dna_s730.fastp.json --html dna_s730.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1011 seconds