Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44635834562(98.5339%)
Q30 bases: 43086927968(95.1146%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44512884541(98.2624%)
Q30 bases: 42755967249(94.384%)

Read1 after filtering:
total reads: 297370270
total bases: 42124893750
Q20 bases: 41819916169(99.276%)
Q30 bases: 40601900576(96.3846%)

Read2 after filtering:
total reads: 297370270
total bases: 42132809902
Q20 bases: 41778066750(99.158%)
Q30 bases: 40603239429(96.3696%)

Filtering result:
reads passed filter: 594740540
reads failed due to low quality: 4402358
reads failed due to too many N: 853168
reads failed due to too short: 3934
reads with adapter trimmed: 147103081
bases trimmed due to adapters: 5568148991

Duplication rate: 21.1566%

Insert size peak (evaluated by paired-end reads): 161

JSON report: dna_s731.fastp.json
HTML report: dna_s731.fastp.html

fastp --in1 dna_s731_1.fastq.gz --in2 dna_s731_2.fastq.gz --out1 dna_s731_1.fastp.fastq.gz --out2 dna_s731_2.fastp.fastq.gz --json dna_s731.fastp.json --html dna_s731.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1030 seconds