Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44509918444(98.2559%)
Q30 bases: 42755663766(94.3834%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44433982619(98.0883%)
Q30 bases: 42521846902(93.8672%)

Read1 after filtering:
total reads: 298021857
total bases: 39750005182
Q20 bases: 39470395990(99.2966%)
Q30 bases: 38349388835(96.4764%)

Read2 after filtering:
total reads: 298021857
total bases: 39761799545
Q20 bases: 39479720614(99.2906%)
Q30 bases: 38501561070(96.8305%)

Filtering result:
reads passed filter: 596043714
reads failed due to low quality: 3912760
reads failed due to too many N: 41046
reads failed due to too short: 2480
reads with adapter trimmed: 268613977
bases trimmed due to adapters: 10527263289

Duplication rate: 20.7863%

Insert size peak (evaluated by paired-end reads): 118

JSON report: dna_s733.fastp.json
HTML report: dna_s733.fastp.html

fastp --in1 dna_s733_1.fastq.gz --in2 dna_s733_2.fastq.gz --out1 dna_s733_1.fastp.fastq.gz --out2 dna_s733_2.fastp.fastq.gz --json dna_s733.fastp.json --html dna_s733.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1014 seconds