Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44487156202(98.2056%)
Q30 bases: 42781192625(94.4397%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44426562552(98.0719%)
Q30 bases: 42582867715(94.0019%)

Read1 after filtering:
total reads: 297671777
total bases: 40278591682
Q20 bases: 39976612122(99.2503%)
Q30 bases: 38836033255(96.4185%)

Read2 after filtering:
total reads: 297671777
total bases: 40290480424
Q20 bases: 39983877655(99.239%)
Q30 bases: 38986781395(96.7643%)

Filtering result:
reads passed filter: 595343554
reads failed due to low quality: 4030548
reads failed due to too many N: 623064
reads failed due to too short: 2834
reads with adapter trimmed: 239614797
bases trimmed due to adapters: 9361326793

Duplication rate: 19.3116%

Insert size peak (evaluated by paired-end reads): 120

JSON report: dna_s736.fastp.json
HTML report: dna_s736.fastp.html

fastp --in1 dna_s736_1.fastq.gz --in2 dna_s736_2.fastq.gz --out1 dna_s736_1.fastp.fastq.gz --out2 dna_s736_2.fastp.fastq.gz --json dna_s736.fastp.json --html dna_s736.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1018 seconds