Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44247614758(97.6769%)
Q30 bases: 42456157090(93.7222%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44244651662(97.6703%)
Q30 bases: 42232038274(93.2275%)

Read1 after filtering:
total reads: 297769585
total bases: 39146942413
Q20 bases: 38841419042(99.2195%)
Q30 bases: 37696437553(96.2947%)

Read2 after filtering:
total reads: 297769585
total bases: 39160555615
Q20 bases: 38876503859(99.2746%)
Q30 bases: 37955730607(96.9234%)

Filtering result:
reads passed filter: 595539170
reads failed due to low quality: 3812126
reads failed due to too many N: 644314
reads failed due to too short: 4390
reads with adapter trimmed: 287892695
bases trimmed due to adapters: 11658864733

Duplication rate: 21.1509%

Insert size peak (evaluated by paired-end reads): 111

JSON report: dna_s745.fastp.json
HTML report: dna_s745.fastp.html

fastp --in1 dna_s745_1.fastq.gz --in2 dna_s745_2.fastq.gz --out1 dna_s745_1.fastp.fastq.gz --out2 dna_s745_2.fastp.fastq.gz --json dna_s745.fastp.json --html dna_s745.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1031 seconds