Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44624663687(98.5092%)
Q30 bases: 43055650975(95.0456%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44556606529(98.359%)
Q30 bases: 42844584914(94.5797%)

Read1 after filtering:
total reads: 297747726
total bases: 41785294416
Q20 bases: 41492626488(99.2996%)
Q30 bases: 40299094953(96.4432%)

Read2 after filtering:
total reads: 297747726
total bases: 41793748076
Q20 bases: 41475630441(99.2388%)
Q30 bases: 40372913435(96.6004%)

Filtering result:
reads passed filter: 595495452
reads failed due to low quality: 4459558
reads failed due to too many N: 41602
reads failed due to too short: 3388
reads with adapter trimmed: 171418485
bases trimmed due to adapters: 6364066619

Duplication rate: 22.4925%

Insert size peak (evaluated by paired-end reads): 154

JSON report: dna_s742.fastp.json
HTML report: dna_s742.fastp.html

fastp --in1 dna_s742_1.fastq.gz --in2 dna_s742_2.fastq.gz --out1 dna_s742_1.fastp.fastq.gz --out2 dna_s742_2.fastp.fastq.gz --json dna_s742.fastp.json --html dna_s742.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 983 seconds