Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44675549869(98.6215%)
Q30 bases: 43098883769(95.141%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44512918198(98.2625%)
Q30 bases: 42739114546(94.3468%)

Read1 after filtering:
total reads: 297453087
total bases: 41474372522
Q20 bases: 41176422834(99.2816%)
Q30 bases: 40018284723(96.4892%)

Read2 after filtering:
total reads: 297453087
total bases: 41484208588
Q20 bases: 41148697221(99.1912%)
Q30 bases: 40039280103(96.5169%)

Filtering result:
reads passed filter: 594906174
reads failed due to low quality: 4374874
reads failed due to too many N: 715058
reads failed due to too short: 3894
reads with adapter trimmed: 180775223
bases trimmed due to adapters: 6899218919

Duplication rate: 19.0185%

Insert size peak (evaluated by paired-end reads): 151

JSON report: dna_s740.fastp.json
HTML report: dna_s740.fastp.html

fastp --in1 dna_s740_1.fastq.gz --in2 dna_s740_2.fastq.gz --out1 dna_s740_1.fastp.fastq.gz --out2 dna_s740_2.fastp.fastq.gz --json dna_s740.fastp.json --html dna_s740.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 998 seconds