Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44423428190(98.065%)
Q30 bases: 42728149706(94.3226%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44425072283(98.0686%)
Q30 bases: 42566509473(93.9658%)

Read1 after filtering:
total reads: 297170072
total bases: 40704965882
Q20 bases: 40389219555(99.2243%)
Q30 bases: 39199923198(96.3026%)

Read2 after filtering:
total reads: 297170072
total bases: 40716639680
Q20 bases: 40390870092(99.1999%)
Q30 bases: 39330631038(96.596%)

Filtering result:
reads passed filter: 594340144
reads failed due to low quality: 4543788
reads failed due to too many N: 1109544
reads failed due to too short: 6524
reads with adapter trimmed: 211564212
bases trimmed due to adapters: 8359092051

Duplication rate: 23.0805%

Insert size peak (evaluated by paired-end reads): 127

JSON report: dna_s746.fastp.json
HTML report: dna_s746.fastp.html

fastp --in1 dna_s746_1.fastq.gz --in2 dna_s746_2.fastq.gz --out1 dna_s746_1.fastp.fastq.gz --out2 dna_s746_2.fastp.fastq.gz --json dna_s746.fastp.json --html dna_s746.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1020 seconds