File Info

Filename
dna_s708.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/cgp_rna_exp0034/B2372Y3LT4/nfcore_rnafusion__73d51683--20260607-225254/fastp/dna_s708.fastp.log
Size
1.4 KB
Published
Jun 08, 2026 1:03 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44605366685(98.4666%)
Q30 bases: 42943980353(94.7991%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44566767281(98.3814%)
Q30 bases: 42759259368(94.3913%)

Read1 after filtering:
total reads: 297866430
total bases: 41592217719
Q20 bases: 41296155036(99.2882%)
Q30 bases: 40004316297(96.1822%)

Read2 after filtering:
total reads: 297866430
total bases: 41596420831
Q20 bases: 41277001752(99.2321%)
Q30 bases: 40096643340(96.3945%)

Filtering result:
reads passed filter: 595732860
reads failed due to low quality: 4192006
reads failed due to too many N: 71662
reads failed due to too short: 3472
reads with adapter trimmed: 188875979
bases trimmed due to adapters: 6794237601

Duplication rate: 22.7405%

Insert size peak (evaluated by paired-end reads): 133

JSON report: dna_s708.fastp.json
HTML report: dna_s708.fastp.html

fastp --in1 dna_s708_1.fastq.gz --in2 dna_s708_2.fastq.gz --out1 dna_s708_1.fastp.fastq.gz --out2 dna_s708_2.fastp.fastq.gz --json dna_s708.fastp.json --html dna_s708.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 966 seconds