Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44615535547(98.489%)
Q30 bases: 42911338986(94.727%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44382886721(97.9755%)
Q30 bases: 42385965289(93.5673%)

Read1 after filtering:
total reads: 297654115
total bases: 41436002538
Q20 bases: 41132531621(99.2676%)
Q30 bases: 39851462749(96.1759%)

Read2 after filtering:
total reads: 297654115
total bases: 41446427077
Q20 bases: 41113572626(99.1969%)
Q30 bases: 39924164975(96.3272%)

Filtering result:
reads passed filter: 595308230
reads failed due to low quality: 4614858
reads failed due to too many N: 72136
reads failed due to too short: 4776
reads with adapter trimmed: 192021386
bases trimmed due to adapters: 7036386014

Duplication rate: 26.8566%

Insert size peak (evaluated by paired-end reads): 134

JSON report: dna_s707.fastp.json
HTML report: dna_s707.fastp.html

fastp --in1 dna_s707_1.fastq.gz --in2 dna_s707_2.fastq.gz --out1 dna_s707_1.fastp.fastq.gz --out2 dna_s707_2.fastp.fastq.gz --json dna_s707.fastp.json --html dna_s707.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 992 seconds