File Info

Filename
dna_s718.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/e2/2bacdd069df230d36145b1594d3250/dna_s718.fastp.log
Size
1.4 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44621225748(98.5016%)
Q30 bases: 43026823507(94.982%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44573701462(98.3967%)
Q30 bases: 42778783389(94.4344%)

Read1 after filtering:
total reads: 297740936
total bases: 41508844917
Q20 bases: 41223909668(99.3136%)
Q30 bases: 40017089324(96.4062%)

Read2 after filtering:
total reads: 297740936
total bases: 41513570964
Q20 bases: 41180711356(99.1982%)
Q30 bases: 39998259874(96.3498%)

Filtering result:
reads passed filter: 595481872
reads failed due to low quality: 4438300
reads failed due to too many N: 77256
reads failed due to too short: 2572
reads with adapter trimmed: 194238362
bases trimmed due to adapters: 6923032760

Duplication rate: 22.7659%

Insert size peak (evaluated by paired-end reads): 129

JSON report: dna_s718.fastp.json
HTML report: dna_s718.fastp.html

fastp --in1 dna_s718_1.fastq.gz --in2 dna_s718_2.fastq.gz --out1 dna_s718_1.fastp.fastq.gz --out2 dna_s718_2.fastp.fastq.gz --json dna_s718.fastp.json --html dna_s718.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 1030 seconds