Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 119828251
total bases: 18094065901
Q20 bases: 17840746644(98.6%)
Q30 bases: 17196087498(95.0372%)

Read2 before filtering:
total reads: 119828251
total bases: 18094065901
Q20 bases: 17775226279(98.2379%)
Q30 bases: 17063627168(94.3051%)

Read1 after filtering:
total reads: 118711267
total bases: 16956876488
Q20 bases: 16823871352(99.2156%)
Q30 bases: 16296220551(96.1039%)

Read2 after filtering:
total reads: 118711267
total bases: 16959862418
Q20 bases: 16814299987(99.1417%)
Q30 bases: 16320431633(96.2297%)

Filtering result:
reads passed filter: 237422534
reads failed due to low quality: 1890632
reads failed due to too many N: 342078
reads failed due to too short: 1258
reads with adapter trimmed: 53178769
bases trimmed due to adapters: 1942590671

Duplication rate: 12.2212%

Insert size peak (evaluated by paired-end reads): 178

JSON report: dna_s769.fastp.json
HTML report: dna_s769.fastp.html

fastp --in1 dna_s769_1.fastq.gz --in2 dna_s769_2.fastq.gz --out1 dna_s769_1.fastp.fastq.gz --out2 dna_s769_2.fastp.fastq.gz --json dna_s769.fastp.json --html dna_s769.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 285 seconds