Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44813308430(98.9256%)
Q30 bases: 43311556635(95.6105%)

Read2 before filtering:
total reads: 300000000
total bases: 45300000000
Q20 bases: 44417951418(98.0529%)
Q30 bases: 42427586629(93.6591%)

Read1 after filtering:
total reads: 296455946
total bases: 42977670621
Q20 bases: 42677540274(99.3017%)
Q30 bases: 41435139669(96.4109%)

Read2 after filtering:
total reads: 296455946
total bases: 42983769004
Q20 bases: 42501919930(98.879%)
Q30 bases: 40964186718(95.3015%)

Filtering result:
reads passed filter: 592911892
reads failed due to low quality: 6260512
reads failed due to too many N: 824112
reads failed due to too short: 3484
reads with adapter trimmed: 96175555
bases trimmed due to adapters: 3581814252

Duplication rate: 21.271%

Insert size peak (evaluated by paired-end reads): 213

JSON report: dna_s747.fastp.json
HTML report: dna_s747.fastp.html

fastp --in1 dna_s747_1.fastq.gz --in2 dna_s747_2.fastq.gz --out1 dna_s747_1.fastp.fastq.gz --out2 dna_s747_2.fastp.fastq.gz --json dna_s747.fastp.json --html dna_s747.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 986 seconds