Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 127559649
total bases: 19261506999
Q20 bases: 18984411367(98.5614%)
Q30 bases: 18330827550(95.1682%)

Read2 before filtering:
total reads: 127559649
total bases: 19261506999
Q20 bases: 18944047385(98.3518%)
Q30 bases: 18218097711(94.5829%)

Read1 after filtering:
total reads: 126338015
total bases: 17974569763
Q20 bases: 17845041123(99.2794%)
Q30 bases: 17329261691(96.4099%)

Read2 after filtering:
total reads: 126338015
total bases: 17977745281
Q20 bases: 17826790521(99.1603%)
Q30 bases: 17321795474(96.3513%)

Filtering result:
reads passed filter: 252676030
reads failed due to low quality: 2087576
reads failed due to too many N: 354434
reads failed due to too short: 1258
reads with adapter trimmed: 59622879
bases trimmed due to adapters: 2210920324

Duplication rate: 12.9848%

Insert size peak (evaluated by paired-end reads): 179

JSON report: dna_s764.fastp.json
HTML report: dna_s764.fastp.html

fastp --in1 dna_s764_1.fastq.gz --in2 dna_s764_2.fastq.gz --out1 dna_s764_1.fastp.fastq.gz --out2 dna_s764_2.fastp.fastq.gz --json dna_s764.fastp.json --html dna_s764.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 311 seconds