Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
No adapter detected for read2

Read1 before filtering:
total reads: 116173625
total bases: 17542217375
Q20 bases: 17325624801(98.7653%)
Q30 bases: 16738133894(95.4163%)

Read2 before filtering:
total reads: 116173625
total bases: 17542217375
Q20 bases: 17230473875(98.2229%)
Q30 bases: 16531895746(94.2406%)

Read1 after filtering:
total reads: 115055067
total bases: 16502462377
Q20 bases: 16386618173(99.298%)
Q30 bases: 15910819075(96.4148%)

Read2 after filtering:
total reads: 115055067
total bases: 16505079072
Q20 bases: 16355078467(99.0912%)
Q30 bases: 15852350450(96.0453%)

Filtering result:
reads passed filter: 230110134
reads failed due to low quality: 1907408
reads failed due to too many N: 328476
reads failed due to too short: 1232
reads with adapter trimmed: 48018842
bases trimmed due to adapters: 1746221139

Duplication rate: 13.9611%

Insert size peak (evaluated by paired-end reads): 178

JSON report: dna_s775.fastp.json
HTML report: dna_s775.fastp.html

fastp --in1 dna_s775_1.fastq.gz --in2 dna_s775_2.fastq.gz --out1 dna_s775_1.fastp.fastq.gz --out2 dna_s775_2.fastp.fastq.gz --json dna_s775.fastp.json --html dna_s775.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 518 seconds