File Info

Filename
Sig_18_Blood.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/d0/a52123984a963526197310fba8943a/Sig_18_Blood.fastp.log
Size
1.5 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62209
total bases: 9331350
Q20 bases: 9169622(98.2668%)
Q30 bases: 8860049(94.9493%)
Q40 bases: 8860049(94.9493%)

Read2 before filtering:
total reads: 62209
total bases: 9331350
Q20 bases: 9099065(97.5107%)
Q30 bases: 8703370(93.2702%)
Q40 bases: 8703370(93.2702%)

Read1 after filtering:
total reads: 62208
total bases: 9019907
Q20 bases: 8892993(98.593%)
Q30 bases: 8607120(95.4236%)
Q40 bases: 8607120(95.4236%)

Read2 after filtering:
total reads: 62208
total bases: 9020205
Q20 bases: 8818679(97.7658%)
Q30 bases: 8456420(93.7498%)
Q40 bases: 8456420(93.7498%)

Filtering result:
reads passed filter: 124416
reads failed due to low quality: 2
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 17648
bases trimmed due to adapters: 622336

Duplication rate: 0.882509%

Insert size peak (evaluated by paired-end reads): 185

JSON report: Sig_18_Blood.fastp.json
HTML report: Sig_18_Blood.fastp.html

fastp --in1 Sig_18_Blood_S4_L002_R1_001.fastq.gz --in2 Sig_18_Blood_S4_L002_R2_001.fastq.gz --out1 Sig_18_Blood/Sig_18_Blood_R1.fastq.gz --out2 Sig_18_Blood/Sig_18_Blood_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json Sig_18_Blood.fastp.json --html Sig_18_Blood.fastp.html --thread 4 
fastp v1.0.1, time used: 2 seconds