File Info

Filename
.command.err
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/63/e3eb864bfd10d8954de732cb4f2331/.command.err
Size
1.5 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62876
total bases: 9431400
Q20 bases: 9273710(98.328%)
Q30 bases: 8979673(95.2104%)
Q40 bases: 8979673(95.2104%)

Read2 before filtering:
total reads: 62876
total bases: 9431400
Q20 bases: 9177845(97.3116%)
Q30 bases: 8818539(93.5019%)
Q40 bases: 8818539(93.5019%)

Read1 after filtering:
total reads: 62875
total bases: 9054085
Q20 bases: 8937938(98.7172%)
Q30 bases: 8673266(95.794%)
Q40 bases: 8673266(95.794%)

Read2 after filtering:
total reads: 62875
total bases: 9054446
Q20 bases: 8842090(97.6547%)
Q30 bases: 8522281(94.1226%)
Q40 bases: 8522281(94.1226%)

Filtering result:
reads passed filter: 125750
reads failed due to low quality: 2
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 20705
bases trimmed due to adapters: 753973

Duplication rate: 1.16897%

Insert size peak (evaluated by paired-end reads): 214

JSON report: HCC1395_tumor.fastp.json
HTML report: HCC1395_tumor.fastp.html

fastp --in1 HCC1395_tumor_S1_L008_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L008_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4 
fastp v1.0.1, time used: 2 seconds