Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ed/283a0033be478e7ebee82df5a11747/.command.sh
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ed/283a0033be478e7ebee82df5a11747/.command.run
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/9a/83d63ee43dab72fc07dabf2a4e8ce9/output/HCC1395_BL_S2_L007_R2_001.fastq.gz
  Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/9a/83d63ee43dab72fc07dabf2a4e8ce9/output/HCC1395_BL_S2_L007_R1_001.fastq.gz
==> STAGING COMPLETE (4 inputs)

Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62452
total bases: 9367800
Q20 bases: 9203672(98.248%)
Q30 bases: 8884176(94.8374%)
Q40 bases: 8884176(94.8374%)

Read2 before filtering:
total reads: 62452
total bases: 9367800
Q20 bases: 9144281(97.614%)
Q30 bases: 8751992(93.4263%)
Q40 bases: 8751992(93.4263%)

Read1 after filtering:
total reads: 62452
total bases: 9015423
Q20 bases: 8886185(98.5665%)
Q30 bases: 8596762(95.3562%)
Q40 bases: 8596762(95.3562%)

Read2 after filtering:
total reads: 62452
total bases: 9015944
Q20 bases: 8824465(97.8762%)
Q30 bases: 8468391(93.9268%)
Q40 bases: 8468391(93.9268%)

Filtering result:
reads passed filter: 124904
reads failed due to low quality: 0
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 19335
bases trimmed due to adapters: 704233

Duplication rate: 0.922308%

Insert size peak (evaluated by paired-end reads): 191

JSON report: HCC1395_BL.fastp.json
HTML report: HCC1395_BL.fastp.html

fastp --in1 HCC1395_BL_S2_L007_R1_001.fastq.gz --in2 HCC1395_BL_S2_L007_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4 
fastp v1.0.1, time used: 2 seconds