Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ca/fc8898f99e8b6ba4ee9bae4874ca7e/output/Sig_18_Blood_S4_L008_R2_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/f8/2073e8cb0f85b30e9b824dc04e0a23/.command.sh Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ca/fc8898f99e8b6ba4ee9bae4874ca7e/output/Sig_18_Blood_S4_L008_R1_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/f8/2073e8cb0f85b30e9b824dc04e0a23/.command.run ==> STAGING COMPLETE (4 inputs) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62447 total bases: 9367050 Q20 bases: 9206865(98.2899%) Q30 bases: 8898683(94.9998%) Q40 bases: 8898683(94.9998%) Read2 before filtering: total reads: 62447 total bases: 9367050 Q20 bases: 9136719(97.5411%) Q30 bases: 8740627(93.3125%) Q40 bases: 8740627(93.3125%) Read1 after filtering: total reads: 62444 total bases: 9057400 Q20 bases: 8931290(98.6077%) Q30 bases: 8646407(95.4624%) Q40 bases: 8646407(95.4624%) Read2 after filtering: total reads: 62444 total bases: 9057509 Q20 bases: 8856079(97.7761%) Q30 bases: 8492378(93.7606%) Q40 bases: 8492378(93.7606%) Filtering result: reads passed filter: 124888 reads failed due to low quality: 6 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 17528 bases trimmed due to adapters: 618585 Duplication rate: 0.869537% Insert size peak (evaluated by paired-end reads): 227 JSON report: Sig_18_Blood.fastp.json HTML report: Sig_18_Blood.fastp.html fastp --in1 Sig_18_Blood_S4_L008_R1_001.fastq.gz --in2 Sig_18_Blood_S4_L008_R2_001.fastq.gz --out1 Sig_18_Blood/Sig_18_Blood_R1.fastq.gz --out2 Sig_18_Blood/Sig_18_Blood_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json Sig_18_Blood.fastp.json --html Sig_18_Blood.fastp.html --thread 4 fastp v1.0.1, time used: 2 seconds