File Info

Filename
Sig_18_Blood.fastp.log
Full Path
s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/3b/4d7f932ae41dba149633556793044c/Sig_18_Blood.fastp.log
Size
1.5 KB
Attempt
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 62576
total bases: 9386400
Q20 bases: 9220394(98.2314%)
Q30 bases: 8906508(94.8874%)
Q40 bases: 8906508(94.8874%)

Read2 before filtering:
total reads: 62576
total bases: 9386400
Q20 bases: 9150674(97.4886%)
Q30 bases: 8747461(93.1929%)
Q40 bases: 8747461(93.1929%)

Read1 after filtering:
total reads: 62574
total bases: 9069868
Q20 bases: 8939493(98.5625%)
Q30 bases: 8650102(95.3719%)
Q40 bases: 8650102(95.3719%)

Read2 after filtering:
total reads: 62574
total bases: 9070141
Q20 bases: 8865826(97.7474%)
Q30 bases: 8496967(93.6806%)
Q40 bases: 8496967(93.6806%)

Filtering result:
reads passed filter: 125148
reads failed due to low quality: 4
reads failed due to too many N: 0
reads failed due to too short: 0
reads with adapter trimmed: 17659
bases trimmed due to adapters: 632299

Duplication rate: 0.941255%

Insert size peak (evaluated by paired-end reads): 170

JSON report: Sig_18_Blood.fastp.json
HTML report: Sig_18_Blood.fastp.html

fastp --in1 Sig_18_Blood_S4_L006_R1_001.fastq.gz --in2 Sig_18_Blood_S4_L006_R2_001.fastq.gz --out1 Sig_18_Blood/Sig_18_Blood_R1.fastq.gz --out2 Sig_18_Blood/Sig_18_Blood_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json Sig_18_Blood.fastp.json --html Sig_18_Blood.fastp.html --thread 4 
fastp v1.0.1, time used: 2 seconds