Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62283 total bases: 9342450 Q20 bases: 9188318(98.3502%) Q30 bases: 8901933(95.2848%) Q40 bases: 8901933(95.2848%) Read2 before filtering: total reads: 62283 total bases: 9342450 Q20 bases: 9094765(97.3488%) Q30 bases: 8740624(93.5582%) Q40 bases: 8740624(93.5582%) Read1 after filtering: total reads: 62280 total bases: 8970133 Q20 bases: 8856940(98.7381%) Q30 bases: 8599982(95.8735%) Q40 bases: 8599982(95.8735%) Read2 after filtering: total reads: 62280 total bases: 8970592 Q20 bases: 8763050(97.6864%) Q30 bases: 8447874(94.173%) Q40 bases: 8447874(94.173%) Filtering result: reads passed filter: 124560 reads failed due to low quality: 6 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 20241 bases trimmed due to adapters: 743413 Duplication rate: 1.08216% Insert size peak (evaluated by paired-end reads): 170 JSON report: HCC1395_tumor.fastp.json HTML report: HCC1395_tumor.fastp.html fastp --in1 HCC1395_tumor_S1_L004_R1_001.fastq.gz --in2 HCC1395_tumor_S1_L004_R2_001.fastq.gz --out1 HCC1395_tumor/HCC1395_tumor_R1.fastq.gz --out2 HCC1395_tumor/HCC1395_tumor_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_tumor.fastp.json --html HCC1395_tumor.fastp.html --thread 4 fastp v1.0.1, time used: 1 seconds