Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/76/b14740d8b4a42c4352d7314bae09a4/.command.sh Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ca/fc8898f99e8b6ba4ee9bae4874ca7e/output/HCC1395_BL_S2_L008_R1_001.fastq.gz Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/76/b14740d8b4a42c4352d7314bae09a4/.command.run Downloading: s3://natera-rnd-pltf-dev-nextflow-scratch-01/work/ca/fc8898f99e8b6ba4ee9bae4874ca7e/output/HCC1395_BL_S2_L008_R2_001.fastq.gz ==> STAGING COMPLETE (4 inputs) Detecting adapter sequence for read1... >Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA Detecting adapter sequence for read2... >Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT Read1 before filtering: total reads: 62634 total bases: 9395100 Q20 bases: 9226123(98.2014%) Q30 bases: 8898467(94.7139%) Q40 bases: 8898467(94.7139%) Read2 before filtering: total reads: 62634 total bases: 9395100 Q20 bases: 9166896(97.571%) Q30 bases: 8763642(93.2789%) Q40 bases: 8763642(93.2789%) Read1 after filtering: total reads: 62634 total bases: 9040417 Q20 bases: 8907386(98.5285%) Q30 bases: 8610838(95.2482%) Q40 bases: 8610838(95.2482%) Read2 after filtering: total reads: 62634 total bases: 9040773 Q20 bases: 8845292(97.8378%) Q30 bases: 8479560(93.7924%) Q40 bases: 8479560(93.7924%) Filtering result: reads passed filter: 125268 reads failed due to low quality: 0 reads failed due to too many N: 0 reads failed due to too short: 0 reads with adapter trimmed: 19271 bases trimmed due to adapters: 709010 Duplication rate: 0.94677% Insert size peak (evaluated by paired-end reads): 182 JSON report: HCC1395_BL.fastp.json HTML report: HCC1395_BL.fastp.html fastp --in1 HCC1395_BL_S2_L008_R1_001.fastq.gz --in2 HCC1395_BL_S2_L008_R2_001.fastq.gz --out1 HCC1395_BL/HCC1395_BL_R1.fastq.gz --out2 HCC1395_BL/HCC1395_BL_R2.fastq.gz --detect_adapter_for_pe --length_required 15 --json HCC1395_BL.fastp.json --html HCC1395_BL.fastp.html --thread 4 fastp v1.0.1, time used: 2 seconds