File Info

Filename
NTC_0001_0001_23KMKGLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion__2cae617--20260515-145204/fastp/NTC_0001_0001_23KMKGLT4_1.fastp.log
Size
1.5 KB
Published
May 16, 2026 1:14 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 3096639
total bases: 467592489
Q20 bases: 400582891(85.6692%)
Q30 bases: 303709431(64.9517%)

Read2 before filtering:
total reads: 3096639
total bases: 467592489
Q20 bases: 426509245(91.2139%)
Q30 bases: 317456958(67.8918%)

Read1 after filtering:
total reads: 502222
total bases: 22015428
Q20 bases: 21310264(96.797%)
Q30 bases: 19943553(90.589%)

Read2 after filtering:
total reads: 502222
total bases: 23207295
Q20 bases: 22575920(97.2794%)
Q30 bases: 21274689(91.6724%)

Filtering result:
reads passed filter: 1004444
reads failed due to low quality: 447376
reads failed due to too many N: 48
reads failed due to too short: 4741410
reads with adapter trimmed: 3579332
bases trimmed due to adapters: 204273937

Duplication rate: 48.7938%

Insert size peak (evaluated by paired-end reads): 36

JSON report: NTC_0001_0001_23KMKGLT4_1.fastp.json
HTML report: NTC_0001_0001_23KMKGLT4_1.fastp.html

fastp --in1 NTC_0001_0001_23KMKGLT4_1_1.fastq.gz --in2 NTC_0001_0001_23KMKGLT4_1_2.fastq.gz --out1 NTC_0001_0001_23KMKGLT4_1_1.fastp.fastq.gz --out2 NTC_0001_0001_23KMKGLT4_1_2.fastp.fastq.gz --json NTC_0001_0001_23KMKGLT4_1.fastp.json --html NTC_0001_0001_23KMKGLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 6 seconds