Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 28063786
total bases: 4237631686
Q20 bases: 4037029156(95.2662%)
Q30 bases: 3755266314(88.6171%)
Read2 before filtering:
total reads: 28063786
total bases: 4237631686
Q20 bases: 4083872879(96.3716%)
Q30 bases: 3792827277(89.5035%)
Read1 after filtering:
total reads: 25494091
total bases: 2814256062
Q20 bases: 2799067871(99.4603%)
Q30 bases: 2738246935(97.2991%)
Read2 after filtering:
total reads: 25494091
total bases: 2831417826
Q20 bases: 2794599971(98.6997%)
Q30 bases: 2706099776(95.574%)
Filtering result:
reads passed filter: 50988182
reads failed due to low quality: 1342204
reads failed due to too many N: 7542
reads failed due to too short: 3789644
reads with adapter trimmed: 42950318
bases trimmed due to adapters: 2155204511
Duplication rate: 42.9419%
Insert size peak (evaluated by paired-end reads): 107
JSON report: tih_rna_sample_00156_23KMKGLT4_1.fastp.json
HTML report: tih_rna_sample_00156_23KMKGLT4_1.fastp.html
fastp --in1 tih_rna_sample_00156_23KMKGLT4_1_1.fastq.gz --in2 tih_rna_sample_00156_23KMKGLT4_1_2.fastq.gz --out1 tih_rna_sample_00156_23KMKGLT4_1_1.fastp.fastq.gz --out2 tih_rna_sample_00156_23KMKGLT4_1_2.fastp.fastq.gz --json tih_rna_sample_00156_23KMKGLT4_1.fastp.json --html tih_rna_sample_00156_23KMKGLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 45 seconds