Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 98313547
total bases: 14845345597
Q20 bases: 14367896282(96.7838%)
Q30 bases: 13682293156(92.1655%)

Read2 before filtering:
total reads: 98313547
total bases: 14845345597
Q20 bases: 14468561005(97.4619%)
Q30 bases: 13743642452(92.5788%)

Read1 after filtering:
total reads: 95737431
total bases: 10881004754
Q20 bases: 10831058103(99.541%)
Q30 bases: 10606301366(97.4754%)

Read2 after filtering:
total reads: 95737431
total bases: 10898392797
Q20 bases: 10811783500(99.2053%)
Q30 bases: 10534288159(96.6591%)

Filtering result:
reads passed filter: 191474862
reads failed due to low quality: 3056544
reads failed due to too many N: 30118
reads failed due to too short: 2065570
reads with adapter trimmed: 156186373
bases trimmed due to adapters: 7240583246

Duplication rate: 44.63%

Insert size peak (evaluated by paired-end reads): 109

JSON report: tih_rna_sample_00482_23KMKGLT4_1.fastp.json
HTML report: tih_rna_sample_00482_23KMKGLT4_1.fastp.html

fastp --in1 tih_rna_sample_00482_23KMKGLT4_1_1.fastq.gz --in2 tih_rna_sample_00482_23KMKGLT4_1_2.fastq.gz --out1 tih_rna_sample_00482_23KMKGLT4_1_1.fastp.fastq.gz --out2 tih_rna_sample_00482_23KMKGLT4_1_2.fastp.fastq.gz --json tih_rna_sample_00482_23KMKGLT4_1.fastp.json --html tih_rna_sample_00482_23KMKGLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 237 seconds