File Info

Filename
tih_rna_sample_00134_23KMKGLT4_1.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion__2cae617--20260515-145204/fastp/tih_rna_sample_00134_23KMKGLT4_1.fastp.log
Size
1.6 KB
Published
May 16, 2026 1:21 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 141679553
total bases: 21393612503
Q20 bases: 20580444967(96.199%)
Q30 bases: 19468370227(91.0009%)

Read2 before filtering:
total reads: 141679553
total bases: 21393612503
Q20 bases: 20673158467(96.6324%)
Q30 bases: 19462820411(90.9749%)

Read1 after filtering:
total reads: 137416282
total bases: 15574766986
Q20 bases: 15440441298(99.1375%)
Q30 bases: 15018941446(96.4312%)

Read2 after filtering:
total reads: 137416282
total bases: 15636274836
Q20 bases: 15446077172(98.7836%)
Q30 bases: 14952361987(95.6261%)

Filtering result:
reads passed filter: 274832564
reads failed due to low quality: 6481948
reads failed due to too many N: 42882
reads failed due to too short: 2001712
reads with adapter trimmed: 224754142
bases trimmed due to adapters: 10474271350

Duplication rate: 39.5403%

Insert size peak (evaluated by paired-end reads): 108

JSON report: tih_rna_sample_00134_23KMKGLT4_1.fastp.json
HTML report: tih_rna_sample_00134_23KMKGLT4_1.fastp.html

fastp --in1 tih_rna_sample_00134_23KMKGLT4_1_1.fastq.gz --in2 tih_rna_sample_00134_23KMKGLT4_1_2.fastq.gz --out1 tih_rna_sample_00134_23KMKGLT4_1_1.fastp.fastq.gz --out2 tih_rna_sample_00134_23KMKGLT4_1_2.fastp.fastq.gz --json tih_rna_sample_00134_23KMKGLT4_1.fastp.json --html tih_rna_sample_00134_23KMKGLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 339 seconds