Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Read1 before filtering:
total reads: 159603286
total bases: 24100096186
Q20 bases: 23380991275(97.0162%)
Q30 bases: 22162077521(91.9585%)
Read2 before filtering:
total reads: 159603286
total bases: 24100096186
Q20 bases: 23541681848(97.6829%)
Q30 bases: 22403424035(92.9599%)
Read1 after filtering:
total reads: 157258913
total bases: 16675900154
Q20 bases: 16601627989(99.5546%)
Q30 bases: 16262510168(97.521%)
Read2 after filtering:
total reads: 157258913
total bases: 16696751825
Q20 bases: 16581197117(99.3079%)
Q30 bases: 16191685111(96.9751%)
Filtering result:
reads passed filter: 314517826
reads failed due to low quality: 3491286
reads failed due to too many N: 46242
reads failed due to too short: 1151218
reads with adapter trimmed: 281858217
bases trimmed due to adapters: 14238011864
Duplication rate: 42.9587%
Insert size peak (evaluated by paired-end reads): 98
JSON report: tih_rna_sample_00153_23KMKGLT4_1.fastp.json
HTML report: tih_rna_sample_00153_23KMKGLT4_1.fastp.html
fastp --in1 tih_rna_sample_00153_23KMKGLT4_1_1.fastq.gz --in2 tih_rna_sample_00153_23KMKGLT4_1_2.fastq.gz --out1 tih_rna_sample_00153_23KMKGLT4_1_1.fastp.fastq.gz --out2 tih_rna_sample_00153_23KMKGLT4_1_2.fastp.fastq.gz --json tih_rna_sample_00153_23KMKGLT4_1.fastp.json --html tih_rna_sample_00153_23KMKGLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000
fastp v0.23.4, time used: 388 seconds