Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 171782233
total bases: 25939117183
Q20 bases: 25129028565(96.877%)
Q30 bases: 24035311781(92.6605%)

Read2 before filtering:
total reads: 171782233
total bases: 25939117183
Q20 bases: 25283273198(97.4716%)
Q30 bases: 23996613764(92.5113%)

Read1 after filtering:
total reads: 168912919
total bases: 19226061742
Q20 bases: 19144294620(99.5747%)
Q30 bases: 18761993253(97.5863%)

Read2 after filtering:
total reads: 168912919
total bases: 19247921243
Q20 bases: 19102846687(99.2463%)
Q30 bases: 18620260556(96.7391%)

Filtering result:
reads passed filter: 337825838
reads failed due to low quality: 4536306
reads failed due to too many N: 53222
reads failed due to too short: 1149100
reads with adapter trimmed: 277126019
bases trimmed due to adapters: 12662293920

Duplication rate: 34.8645%

Insert size peak (evaluated by paired-end reads): 108

JSON report: tih_rna_sample_00440_23KMKGLT4_1.fastp.json
HTML report: tih_rna_sample_00440_23KMKGLT4_1.fastp.html

fastp --in1 tih_rna_sample_00440_23KMKGLT4_1_1.fastq.gz --in2 tih_rna_sample_00440_23KMKGLT4_1_2.fastq.gz --out1 tih_rna_sample_00440_23KMKGLT4_1_1.fastp.fastq.gz --out2 tih_rna_sample_00440_23KMKGLT4_1_2.fastp.fastq.gz --json tih_rna_sample_00440_23KMKGLT4_1.fastp.json --html tih_rna_sample_00440_23KMKGLT4_1.fastp.html --thread 12 --detect_adapter_for_pe --reads_to_process 300000000 
fastp v0.23.4, time used: 455 seconds