MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-05-16, 14:40 UTC based on data in: /tmp/nxf.PyJYHgzY0E

General Statistics

Showing ⁴⁸⁰/₄₈₀ rows and ⁵⁵/₆₂ columns.

Sample Name	Total Reads	Expected Distinct	RNA contaminated	RNA contamination %	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	Reads	Frac Unmapped	Frac Dupes	Unique Reads	Frac Reads On Target	Frac Pairs On Target	Frac Reads Off Target	Frac Pairs Off Target	Reads On Target	Pairs On Target	Reads Off Target	Pairs Off Target	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	N Q30	GC Bias	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
FFPE_HD789_02_RNA_0011_23KMKGLT4_1	9999000000	425342958	Yes	62.63%	156.6bp	143.0bp	0.07%	1.52%	0.48%	0.00%	0.15%	4.44%	0.76%	0.00%	591587092	0.00%	0.45%	324145760	0.91%	0.94%	0.08%	0.06%	295445618	149791333	25812759	10266272	606.82	270.00	0.72%	0.62%	0.97	0.000				182bp	420bp	45.4%	0.0%	95.8%	89.4%	96.1%	284.2M	30.4%	97.0%	75981.5Mb	591.6M	55.4%	98.6%	49.9%
FFPE_HD789_02_RNA_0011_23KMKGLT4_1_1																																	156.6bp	96.2%	284.5M																84.1%	54%	151bp	151bp	27%	398.3M
FFPE_HD789_02_RNA_0011_23KMKGLT4_1_2																																																			82.5%	55%	151bp	151bp	27%	398.3M
FFPE_HD789_02_RNA_0011_23KMKGLT4_1_trimmed_1																																																			82.3%	55%	132bp	151bp	18%	295.8M	82.3%	55%	132bp	151bp	18%	295.8M
FFPE_HD789_02_RNA_0011_23KMKGLT4_1_trimmed_2																																																			81.6%	55%	132bp	151bp	18%	295.8M	81.6%	55%	132bp	151bp	18%	295.8M
FFPE_V4_0001_RNA_0001_23KMKGLT4_1	9999000000	371023703	No	0.00%	152.9bp	141.0bp	0.06%	1.48%	1.07%	0.00%	0.11%	3.98%	1.45%	0.00%	591291068	0.01%	0.49%	299359235	0.90%	0.93%	0.09%	0.07%	270726320	137178470	25447740	10320872	548.95	135.00	0.60%	0.52%	0.97	0.000				182bp	428bp	49.6%	0.0%	95.6%	89.0%	95.8%	283.1M	31.6%	96.9%	75539.0Mb	591.3M	55.0%	98.5%	51.9%
FFPE_V4_0001_RNA_0001_23KMKGLT4_1_1																																	152.9bp	95.4%	282.0M																83.2%	54%	151bp	151bp	27%	380.4M
FFPE_V4_0001_RNA_0001_23KMKGLT4_1_2																																																			82.3%	55%	151bp	151bp	27%	380.4M
FFPE_V4_0001_RNA_0001_23KMKGLT4_1_trimmed_1																																																			81.6%	54%	132bp	147bp	18%	295.6M	81.6%	54%	132bp	147bp	18%	295.6M
FFPE_V4_0001_RNA_0001_23KMKGLT4_1_trimmed_2																																																			81.7%	55%	132bp	147bp	18%	295.6M	81.7%	55%	132bp	147bp	18%	295.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_1	9999000000	212533532	No	0.00%	146.7bp	134.0bp	0.04%	1.49%	0.79%	0.00%	0.06%	3.90%	1.06%	0.00%	590871388	0.01%	0.61%	231247941	0.89%	0.93%	0.09%	0.07%	206912207	105028556	20493129	8322158	396.32	78.00	0.57%	0.48%	0.97	0.000				156bp	305bp	61.3%	0.0%	95.0%	83.2%	94.4%	278.9M	33.4%	96.6%	73036.4Mb	590.9M	58.5%	98.5%	57.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_10	9999000000	317661858	Yes	0.00%	149.3bp	137.0bp	0.05%	1.31%	0.69%	0.00%	0.10%	3.63%	0.91%	0.00%	588866432	0.01%	0.51%	288560371	0.90%	0.93%	0.09%	0.07%	259901240	131614135	25345502	10537029	505.02	138.00	0.60%	0.52%	0.97	0.000				164bp	368bp	51.3%	0.0%	95.5%	89.7%	96.0%	282.8M	26.7%	96.7%	73451.3Mb	588.9M	53.9%	98.1%	56.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_10_1																																	149.3bp	95.8%	281.9M																83.3%	53%	151bp	151bp	27%	346.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_10_2																																																			83.0%	54%	151bp	151bp	27%	346.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_10_trimmed_1																																																			82.2%	53%	129bp	142bp	27%	294.4M	82.2%	53%	129bp	142bp	27%	294.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_10_trimmed_2																																																			83.0%	54%	129bp	142bp	18%	294.4M	83.0%	54%	129bp	142bp	18%	294.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_11	9999000000	309211034	Yes	0.00%	148.4bp	136.0bp	0.05%	1.23%	0.65%	0.00%	0.09%	3.40%	0.86%	0.00%	589027222	0.01%	0.53%	275416328	0.89%	0.92%	0.10%	0.08%	245616673	124407948	26465123	11135672	474.23	130.00	0.60%	0.52%	0.97	0.000				163bp	346bp	53.5%	0.0%	95.2%	89.5%	96.0%	282.7M	31.3%	96.6%	73813.3Mb	589.0M	54.2%	98.2%	56.2%
FFPE_V4_0001_RNA_0005_23KMKGLT4_11_1																																	148.4bp	95.5%	281.2M																83.2%	53%	151bp	151bp	27%	328.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_11_2																																																			82.6%	54%	151bp	151bp	27%	328.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_11_trimmed_1																																																			82.6%	54%	130bp	142bp	27%	294.5M	82.6%	54%	130bp	142bp	27%	294.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_11_trimmed_2																																																			82.9%	54%	130bp	142bp	18%	294.5M	82.9%	54%	130bp	142bp	18%	294.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_12	9999000000	286326479	No	0.00%	143.6bp	132.0bp	0.05%	1.23%	0.64%	0.00%	0.09%	3.38%	0.85%	0.00%	585956864	0.01%	0.55%	262797497	0.88%	0.91%	0.10%	0.09%	232508423	117649247	26944776	11570845	435.27	120.00	0.59%	0.51%	0.97	0.000				151bp	301bp	55.5%	0.0%	95.0%	89.2%	95.9%	281.0M	30.2%	96.7%	72118.8Mb	586.0M	54.1%	98.2%	59.9%
FFPE_V4_0001_RNA_0005_23KMKGLT4_12_1																																	143.6bp	95.4%	279.4M																82.4%	53%	151bp	151bp	27%	298.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_12_2																																																			81.7%	54%	151bp	151bp	27%	298.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_12_trimmed_1																																																			82.5%	53%	127bp	137bp	18%	293.0M	82.5%	53%	127bp	137bp	18%	293.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_12_trimmed_2																																																			82.7%	54%	127bp	137bp	18%	293.0M	82.7%	54%	127bp	137bp	18%	293.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_13	9999000000	276381589	No	0.00%	146.8bp	136.0bp	0.05%	1.19%	0.62%	0.00%	0.09%	3.30%	0.83%	0.00%	589585440	0.01%	0.56%	258393600	0.88%	0.90%	0.11%	0.10%	226625747	114797419	28416939	12265335	430.62	120.00	0.59%	0.51%	0.97	0.000				156bp	313bp	56.5%	0.0%	94.6%	89.5%	96.0%	283.0M	32.6%	96.7%	73376.4Mb	589.6M	54.0%	98.3%	58.0%
FFPE_V4_0001_RNA_0005_23KMKGLT4_13_1																																	146.8bp	95.0%	280.2M																82.8%	53%	151bp	151bp	27%	309.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_13_2																																																			82.2%	54%	151bp	151bp	27%	309.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_13_trimmed_1																																																			82.6%	53%	129bp	137bp	18%	294.8M	82.6%	53%	129bp	137bp	18%	294.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_13_trimmed_2																																																			82.9%	54%	129bp	137bp	18%	294.8M	82.9%	54%	129bp	137bp	18%	294.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_14	9999000000	210194317	No	0.00%	135.0bp	125.0bp	0.06%	1.20%	0.63%	0.00%	0.11%	3.32%	0.83%	0.00%	563824018	0.01%	0.62%	212570765	0.86%	0.88%	0.13%	0.12%	182482358	92187625	26767984	11999852	322.47	88.00	0.57%	0.49%	0.97	0.000				137bp	249bp	62.7%	0.0%	94.6%	89.7%	96.0%	270.7M	35.3%	96.8%	67605.8Mb	563.8M	53.3%	98.0%	65.9%
FFPE_V4_0001_RNA_0005_23KMKGLT4_14_1																																	135.0bp	95.1%	268.1M																83.9%	52%	151bp	151bp	27%	287.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_14_2																																																			82.2%	53%	151bp	151bp	27%	287.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_14_trimmed_1																																																			84.0%	53%	124bp	127bp	18%	281.9M	84.0%	53%	124bp	127bp	18%	281.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_14_trimmed_2																																																			83.3%	53%	124bp	127bp	18%	281.9M	83.3%	53%	124bp	127bp	18%	281.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_15	9999000000	275765424	No	0.00%	143.7bp	133.0bp	0.05%	1.17%	0.61%	0.00%	0.09%	3.24%	0.82%	0.00%	589692622	0.01%	0.56%	256861393	0.88%	0.90%	0.11%	0.10%	224901355	113846872	28578365	12457218	422.53	118.00	0.59%	0.51%	0.97	0.000				153bp	299bp	56.8%	0.0%	94.6%	89.8%	96.0%	283.2M	33.8%	96.8%	73323.0Mb	589.7M	53.8%	98.3%	59.1%
FFPE_V4_0001_RNA_0005_23KMKGLT4_15_1																																	143.7bp	95.1%	280.3M																82.5%	53%	151bp	151bp	27%	309.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_15_2																																																			81.9%	53%	151bp	151bp	27%	309.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_15_trimmed_1																																																			82.3%	53%	128bp	137bp	18%	294.8M	82.3%	53%	128bp	137bp	18%	294.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_15_trimmed_2																																																			82.7%	54%	129bp	137bp	18%	294.8M	82.7%	54%	129bp	137bp	18%	294.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_16	9999000000	281948590	No	0.00%	139.6bp	129.0bp	0.05%	1.20%	0.62%	0.00%	0.10%	3.31%	0.83%	0.00%	581911482	0.01%	0.56%	255726216	0.88%	0.90%	0.11%	0.10%	223856823	113234814	28480359	12480775	411.70	115.00	0.59%	0.51%	0.97	0.000				145bp	273bp	56.4%	0.0%	94.6%	89.3%	95.9%	279.0M	33.2%	96.8%	71032.8Mb	581.9M	54.0%	98.2%	62.0%
FFPE_V4_0001_RNA_0005_23KMKGLT4_16_1																																	139.6bp	95.0%	276.5M																81.5%	53%	151bp	151bp	27%	296.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_16_2																																																			81.5%	54%	151bp	151bp	27%	296.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_16_trimmed_1																																																			81.6%	53%	126bp	132bp	18%	291.0M	81.6%	53%	126bp	132bp	18%	291.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_16_trimmed_2																																																			82.5%	54%	126bp	132bp	18%	291.0M	82.5%	54%	126bp	132bp	18%	291.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_17	9999000000	376341037	No	0.00%	150.2bp	138.0bp	0.06%	1.39%	0.71%	0.00%	0.10%	3.84%	0.94%	0.00%	589094994	0.01%	0.47%	309866778	0.91%	0.93%	0.08%	0.07%	281899234	142789681	24755643	9973472	559.79	154.00	0.60%	0.53%	0.97	0.000				175bp	424bp	47.7%	0.0%	95.8%	89.6%	96.0%	282.8M	25.9%	96.6%	73785.2Mb	589.1M	53.7%	98.2%	54.6%
FFPE_V4_0001_RNA_0005_23KMKGLT4_17_1																																	150.2bp	95.9%	282.5M																83.2%	53%	151bp	151bp	27%	342.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_17_2																																																			82.7%	54%	151bp	151bp	27%	342.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_17_trimmed_1																																																			82.2%	53%	130bp	142bp	27%	294.5M	82.2%	53%	130bp	142bp	27%	294.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_17_trimmed_2																																																			82.7%	53%	130bp	142bp	18%	294.5M	82.7%	53%	130bp	142bp	18%	294.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_18	9999000000	289753831	No	0.00%	143.9bp	132.0bp	0.06%	1.32%	0.69%	0.00%	0.11%	3.66%	0.90%	0.00%	588427540	0.01%	0.55%	266772655	0.89%	0.92%	0.09%	0.08%	238266583	120567961	25316110	10710982	450.47	124.00	0.59%	0.52%	0.97	0.000				155bp	342bp	55.0%	0.0%	95.5%	90.0%	96.1%	282.8M	30.8%	96.7%	72230.3Mb	588.4M	53.2%	98.1%	59.9%
FFPE_V4_0001_RNA_0005_23KMKGLT4_18_1																																	143.9bp	95.8%	281.8M																84.8%	52%	151bp	151bp	27%	361.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_18_2																																																			84.0%	53%	151bp	151bp	27%	361.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_18_trimmed_1																																																			83.4%	53%	127bp	137bp	27%	294.2M	83.4%	53%	127bp	137bp	27%	294.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_18_trimmed_2																																																			83.7%	53%	127bp	137bp	18%	294.2M	83.7%	53%	127bp	137bp	18%	294.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_19	9999000000	334103196	No	0.00%	146.8bp	135.0bp	0.06%	1.25%	0.66%	0.00%	0.10%	3.45%	0.87%	0.00%	589044782	0.01%	0.52%	282106225	0.89%	0.92%	0.10%	0.08%	251413888	127315444	27358182	11580568	481.70	134.00	0.60%	0.52%	0.97	0.000				159bp	335bp	52.4%	0.0%	95.1%	89.2%	95.9%	282.6M	29.4%	96.8%	73177.0Mb	589.0M	53.9%	98.2%	57.5%
FFPE_V4_0001_RNA_0005_23KMKGLT4_19_1																																	146.8bp	95.4%	280.9M																82.3%	53%	151bp	151bp	27%	312.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_19_2																																																			81.8%	53%	151bp	151bp	27%	312.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_19_trimmed_1																																																			82.1%	53%	128bp	137bp	18%	294.5M	82.1%	53%	128bp	137bp	18%	294.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_19_trimmed_2																																																			82.5%	54%	128bp	142bp	18%	294.5M	82.5%	54%	128bp	142bp	18%	294.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_1_1																																	146.7bp	94.5%	279.1M																83.7%	57%	151bp	151bp	18%	316.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_1_2																																																			85.0%	57%	151bp	151bp	27%	316.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_1_trimmed_1																																																			83.2%	58%	128bp	137bp	9%	295.4M	83.2%	58%	128bp	137bp	9%	295.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_1_trimmed_2																																																			85.2%	58%	128bp	137bp	18%	295.4M	85.2%	58%	128bp	137bp	18%	295.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_2	9999000000	226685202	No	0.00%	144.9bp	133.0bp	0.04%	1.33%	0.73%	0.00%	0.06%	3.56%	0.96%	0.00%	590060258	0.01%	0.58%	245949069	0.89%	0.92%	0.09%	0.08%	219448314	111283194	22792049	9461213	414.34	90.00	0.58%	0.49%	0.97	0.000				152bp	290bp	58.7%	0.0%	95.3%	85.7%	95.0%	280.4M	32.1%	96.6%	72477.2Mb	590.1M	57.6%	98.3%	59.0%
FFPE_V4_0001_RNA_0005_23KMKGLT4_20	9999000000	289584326	No	0.00%	142.6bp	131.0bp	0.06%	1.23%	0.65%	0.00%	0.10%	3.40%	0.85%	0.00%	588741218	0.01%	0.55%	265121236	0.88%	0.91%	0.10%	0.09%	234340855	118571084	27402676	11823580	436.01	122.00	0.59%	0.51%	0.97	0.000				149bp	296bp	55.3%	0.0%	94.9%	89.2%	95.9%	282.3M	32.0%	96.8%	72047.6Mb	588.7M	53.8%	98.1%	60.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_20_1																																	142.6bp	95.3%	280.6M																83.0%	53%	151bp	151bp	27%	316.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_20_2																																																			82.2%	53%	151bp	151bp	27%	316.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_20_trimmed_1																																																			82.6%	53%	126bp	137bp	18%	294.4M	82.6%	53%	126bp	137bp	18%	294.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_20_trimmed_2																																																			82.8%	54%	126bp	137bp	18%	294.4M	82.8%	54%	126bp	137bp	18%	294.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_21	9999000000	243716761	No	0.00%	143.4bp	132.0bp	0.05%	1.22%	0.63%	0.00%	0.10%	3.37%	0.84%	0.00%	555727040	0.01%	0.56%	242598805	0.88%	0.90%	0.11%	0.10%	212766056	107670294	26745049	11670687	398.06	110.00	0.58%	0.51%	0.97	0.000				150bp	296bp	56.7%	0.0%	94.7%	89.6%	96.0%	266.8M	32.0%	96.8%	68347.3Mb	555.7M	53.7%	98.2%	60.2%
FFPE_V4_0001_RNA_0005_23KMKGLT4_21_1																																	143.4bp	95.1%	264.2M																82.4%	53%	151bp	151bp	27%	282.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_21_2																																																			82.0%	53%	151bp	151bp	27%	282.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_21_trimmed_1																																																			82.5%	53%	127bp	137bp	18%	277.9M	82.5%	53%	127bp	137bp	18%	277.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_21_trimmed_2																																																			83.0%	53%	127bp	137bp	18%	277.9M	83.0%	53%	127bp	137bp	18%	277.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_22	9999000000	271628855	No	0.00%	141.1bp	130.0bp	0.05%	1.20%	0.62%	0.00%	0.10%	3.31%	0.83%	0.00%	562737130	0.01%	0.55%	250743464	0.88%	0.91%	0.11%	0.09%	220792348	111668611	26712778	11627944	407.64	114.00	0.59%	0.51%	0.97	0.000				147bp	283bp	55.8%	0.0%	94.7%	89.2%	95.9%	269.8M	33.7%	96.9%	68892.0Mb	562.7M	53.8%	98.2%	61.5%
FFPE_V4_0001_RNA_0005_23KMKGLT4_22_1																																	141.1bp	95.2%	267.9M																81.7%	53%	151bp	151bp	27%	286.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_22_2																																																			81.4%	53%	151bp	151bp	27%	286.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_22_trimmed_1																																																			81.8%	53%	126bp	132bp	18%	281.4M	81.8%	53%	126bp	132bp	18%	281.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_22_trimmed_2																																																			82.3%	53%	126bp	137bp	18%	281.4M	82.3%	53%	126bp	137bp	18%	281.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_23	9999000000	268843756	No	0.00%	144.5bp	134.0bp	0.05%	1.17%	0.61%	0.00%	0.09%	3.25%	0.81%	0.00%	588867772	0.01%	0.56%	256410695	0.88%	0.90%	0.11%	0.10%	225321424	114013990	27731849	12017027	421.13	119.00	0.59%	0.51%	0.97	0.000				153bp	300bp	56.8%	0.0%	94.6%	89.5%	96.0%	282.6M	33.8%	96.8%	73004.6Mb	588.9M	53.6%	98.1%	59.5%
FFPE_V4_0001_RNA_0005_23KMKGLT4_23_1																																	144.5bp	95.2%	280.3M																83.5%	53%	151bp	151bp	27%	346.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_23_2																																																			82.7%	53%	151bp	151bp	27%	346.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_23_trimmed_1																																																			82.4%	53%	128bp	137bp	27%	294.4M	82.4%	53%	128bp	137bp	27%	294.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_23_trimmed_2																																																			82.6%	53%	128bp	137bp	18%	294.4M	82.6%	53%	128bp	137bp	18%	294.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_24	9999000000	282805028	No	0.00%	142.7bp	132.0bp	0.05%	1.19%	0.61%	0.00%	0.10%	3.29%	0.81%	0.00%	589301216	0.01%	0.56%	258285570	0.87%	0.90%	0.11%	0.10%	225849798	114281487	29067419	12688306	418.32	118.00	0.59%	0.51%	0.97	0.000				148bp	283bp	56.5%	0.0%	94.5%	89.3%	95.9%	282.7M	33.3%	96.7%	72178.1Mb	589.3M	53.7%	98.2%	61.0%
FFPE_V4_0001_RNA_0005_23KMKGLT4_24_1																																	142.7bp	95.0%	279.9M																82.7%	53%	151bp	151bp	27%	323.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_24_2																																																			82.3%	54%	151bp	151bp	27%	323.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_24_trimmed_1																																																			82.1%	53%	127bp	137bp	18%	294.7M	82.1%	53%	127bp	137bp	18%	294.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_24_trimmed_2																																																			82.7%	53%	127bp	137bp	18%	294.7M	82.7%	53%	127bp	137bp	18%	294.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_25	9999000000	259359115	No	0.00%	149.2bp	136.0bp	0.05%	1.36%	0.72%	0.00%	0.08%	3.75%	0.94%	0.00%	587832350	0.01%	0.56%	256941346	0.90%	0.93%	0.09%	0.07%	231181038	117080241	22653828	9336307	448.52	115.00	0.59%	0.51%	0.97	0.000				170bp	398bp	56.6%	0.0%	95.9%	90.0%	96.1%	282.5M	34.0%	96.7%	73332.5Mb	587.8M	54.2%	98.0%	56.1%
FFPE_V4_0001_RNA_0005_23KMKGLT4_25_1																																	149.2bp	96.1%	282.4M																85.1%	53%	151bp	151bp	27%	359.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_25_2																																																			84.1%	54%	151bp	151bp	27%	359.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_25_trimmed_1																																																			83.7%	53%	129bp	142bp	27%	293.9M	83.7%	53%	129bp	142bp	27%	293.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_25_trimmed_2																																																			84.0%	54%	129bp	142bp	18%	293.9M	84.0%	54%	129bp	142bp	18%	293.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_26	9999000000	244476423	No	0.00%	152.8bp	140.0bp	0.05%	1.27%	0.66%	0.00%	0.08%	3.53%	0.88%	0.00%	588232184	0.01%	0.59%	241278721	0.88%	0.91%	0.10%	0.09%	213018916	108032333	25010533	10476333	419.38	110.00	0.58%	0.51%	0.97	0.000				176bp	410bp	59.3%	0.0%	95.2%	90.1%	96.1%	282.8M	35.1%	96.7%	74278.8Mb	588.2M	53.6%	98.0%	53.3%
FFPE_V4_0001_RNA_0005_23KMKGLT4_26_1																																	152.8bp	95.5%	280.9M																84.5%	53%	151bp	151bp	27%	334.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_26_2																																																			83.7%	53%	151bp	151bp	27%	334.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_26_trimmed_1																																																			83.7%	53%	131bp	147bp	27%	294.1M	83.7%	53%	131bp	147bp	27%	294.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_26_trimmed_2																																																			84.0%	53%	131bp	147bp	18%	294.1M	84.0%	53%	131bp	147bp	18%	294.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_27	9999000000	187946146	No	0.00%	148.8bp	136.0bp	0.05%	1.22%	0.64%	0.00%	0.08%	3.40%	0.85%	0.00%	409409310	0.01%	0.55%	185753835	0.88%	0.91%	0.10%	0.09%	164171418	83117940	19404707	8262473	315.11	82.00	0.57%	0.48%	0.97	0.000				162bp	345bp	54.9%	0.0%	94.9%	89.5%	96.0%	196.6M	31.3%	96.7%	51125.5Mb	409.4M	53.9%	98.1%	56.6%
FFPE_V4_0001_RNA_0005_23KMKGLT4_27_1																																	148.8bp	95.3%	195.0M																81.0%	53%	151bp	151bp	27%	208.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_27_2																																																			80.2%	54%	151bp	151bp	27%	208.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_27_trimmed_1																																																			81.0%	53%	129bp	142bp	18%	204.7M	81.0%	53%	129bp	142bp	18%	204.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_27_trimmed_2																																																			81.1%	54%	129bp	142bp	18%	204.7M	81.1%	54%	129bp	142bp	18%	204.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_28	9999000000	210111995	No	0.00%	145.6bp	133.0bp	0.04%	1.20%	0.62%	0.00%	0.08%	3.34%	0.83%	0.00%	569419776	0.01%	0.64%	202549476	0.86%	0.89%	0.13%	0.11%	173654358	87950651	25793824	11299189	325.38	86.00	0.57%	0.49%	0.97	0.000				156bp	320bp	64.8%	0.0%	94.7%	89.8%	96.1%	273.5M	38.0%	96.8%	70595.0Mb	569.4M	53.5%	98.2%	58.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_28_1																																	145.6bp	95.2%	270.9M																84.2%	53%	151bp	151bp	27%	290.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_28_2																																																			83.3%	53%	151bp	151bp	27%	290.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_28_trimmed_1																																																			84.2%	53%	128bp	137bp	18%	284.7M	84.2%	53%	128bp	137bp	18%	284.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_28_trimmed_2																																																			84.3%	53%	128bp	137bp	18%	284.7M	84.3%	53%	128bp	137bp	18%	284.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_29	9999000000	181428238	No	0.00%	142.6bp	131.0bp	0.05%	1.19%	0.62%	0.00%	0.09%	3.29%	0.82%	0.00%	521045988	0.01%	0.65%	184858698	0.85%	0.88%	0.13%	0.12%	157826695	79899285	24089590	10654361	291.26	76.00	0.56%	0.48%	0.97	0.000				150bp	294bp	64.9%	0.0%	94.6%	89.6%	96.0%	250.1M	37.4%	96.7%	64026.5Mb	521.0M	53.6%	98.1%	60.2%
FFPE_V4_0001_RNA_0005_23KMKGLT4_29_1																																	142.6bp	95.1%	247.7M																83.9%	52%	151bp	151bp	27%	265.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_29_2																																																			82.6%	53%	151bp	151bp	27%	265.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_29_trimmed_1																																																			84.0%	53%	127bp	137bp	18%	260.5M	84.0%	53%	127bp	137bp	18%	260.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_29_trimmed_2																																																			83.7%	53%	127bp	137bp	18%	260.5M	83.7%	53%	127bp	137bp	18%	260.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_2_1																																	144.9bp	95.1%	280.5M																82.4%	56%	151bp	151bp	18%	313.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_2_2																																																			82.7%	57%	151bp	151bp	27%	313.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_2_trimmed_1																																																			82.0%	57%	127bp	137bp	9%	295.0M	82.0%	57%	127bp	137bp	9%	295.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_2_trimmed_2																																																			83.0%	57%	127bp	137bp	18%	295.0M	83.0%	57%	127bp	137bp	18%	295.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_3	9999000000	248457543	No	0.00%	143.7bp	132.0bp	0.04%	1.26%	0.70%	0.00%	0.07%	3.40%	0.92%	0.00%	590215998	0.01%	0.60%	233718138	0.88%	0.91%	0.10%	0.09%	205743488	104318996	24451963	10414994	383.75	88.00	0.58%	0.49%	0.97	0.000				150bp	282bp	60.8%	0.0%	95.1%	87.3%	95.5%	281.7M	34.4%	96.6%	72443.1Mb	590.2M	56.9%	98.4%	59.7%
FFPE_V4_0001_RNA_0005_23KMKGLT4_30	9999000000	162710220	No	0.00%	139.6bp	129.0bp	0.04%	1.17%	0.62%	0.00%	0.08%	3.24%	0.82%	0.00%	524497452	0.01%	0.70%	159709170	0.84%	0.87%	0.15%	0.13%	133460625	67510933	23256944	10440507	239.16	60.00	0.55%	0.45%	0.97	0.000				144bp	269bp	69.9%	0.0%	94.6%	89.1%	95.9%	251.5M	42.5%	96.7%	63743.2Mb	524.5M	54.0%	98.1%	62.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_30_1																																	139.6bp	95.1%	249.5M																84.6%	53%	151bp	151bp	27%	267.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_30_2																																																			83.1%	53%	151bp	151bp	27%	267.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_30_trimmed_1																																																			84.7%	53%	126bp	132bp	18%	262.2M	84.7%	53%	126bp	132bp	18%	262.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_30_trimmed_2																																																			84.2%	54%	126bp	132bp	18%	262.2M	84.2%	54%	126bp	132bp	18%	262.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_31	9999000000	164640156	No	0.00%	143.8bp	133.0bp	0.04%	1.15%	0.61%	0.00%	0.08%	3.20%	0.82%	0.00%	520835764	0.01%	0.68%	168761197	0.84%	0.87%	0.14%	0.13%	142301305	72019998	23615285	10575454	259.42	67.00	0.55%	0.47%	0.97	0.000				149bp	287bp	68.0%	0.0%	94.6%	89.8%	96.1%	250.3M	42.4%	96.8%	64212.9Mb	520.8M	53.7%	98.1%	60.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_31_1																																	143.8bp	95.1%	247.7M																84.5%	53%	151bp	151bp	27%	265.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_31_2																																																			83.2%	53%	151bp	151bp	27%	265.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_31_trimmed_1																																																			84.5%	53%	127bp	137bp	18%	260.4M	84.5%	53%	127bp	137bp	18%	260.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_31_trimmed_2																																																			84.2%	53%	127bp	137bp	18%	260.4M	84.2%	53%	127bp	137bp	18%	260.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_32	9999000000	176565073	No	0.00%	142.3bp	131.0bp	0.04%	1.15%	0.60%	0.00%	0.08%	3.20%	0.81%	0.00%	551110574	0.01%	0.68%	175558798	0.84%	0.87%	0.14%	0.13%	146935588	74371282	25433988	11394669	266.14	68.00	0.56%	0.47%	0.97	0.000				147bp	278bp	68.5%	0.0%	94.3%	89.1%	95.9%	264.3M	40.6%	96.8%	67621.5Mb	551.1M	53.9%	98.1%	61.2%
FFPE_V4_0001_RNA_0005_23KMKGLT4_32_1																																	142.3bp	94.8%	261.3M																84.1%	53%	151bp	151bp	27%	281.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_32_2																																																			83.3%	53%	151bp	151bp	27%	281.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_32_trimmed_1																																																			84.2%	53%	127bp	137bp	18%	275.6M	84.2%	53%	127bp	137bp	18%	275.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_32_trimmed_2																																																			84.4%	54%	127bp	137bp	18%	275.6M	84.4%	54%	127bp	137bp	18%	275.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_33	9999000000	260544308	No	0.00%	148.3bp	134.0bp	0.05%	1.38%	0.72%	0.00%	0.09%	3.77%	0.95%	0.00%	588212780	0.01%	0.56%	259510557	0.90%	0.92%	0.09%	0.08%	232778285	117904932	23570862	9725334	450.11	116.00	0.59%	0.51%	0.97	0.000				166bp	385bp	56.2%	0.0%	95.9%	89.6%	96.0%	282.4M	30.2%	96.6%	72721.0Mb	588.2M	54.1%	98.0%	56.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_33_1																																	148.3bp	96.0%	282.3M																85.3%	53%	151bp	151bp	27%	386.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_33_2																																																			84.5%	54%	151bp	151bp	27%	386.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_33_trimmed_1																																																			83.4%	53%	128bp	142bp	27%	294.1M	83.4%	53%	128bp	142bp	27%	294.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_33_trimmed_2																																																			83.7%	54%	128bp	142bp	18%	294.1M	83.7%	54%	128bp	142bp	18%	294.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_34	9990000000	240322855	No	0.00%	149.5bp	136.0bp	0.05%	1.29%	0.67%	0.00%	0.09%	3.58%	0.89%	0.00%	588446468	0.01%	0.60%	235394620	0.88%	0.91%	0.10%	0.09%	207613500	105192434	24650441	10430131	401.38	105.00	0.58%	0.50%	0.97	0.000				166bp	376bp	60.3%	0.0%	95.4%	89.8%	96.1%	282.7M	35.9%	96.7%	73443.7Mb	588.4M	53.6%	98.1%	56.0%
FFPE_V4_0001_RNA_0005_23KMKGLT4_34_1																																	149.5bp	95.6%	281.4M																84.3%	53%	151bp	151bp	27%	313.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_34_2																																																			83.5%	53%	151bp	151bp	27%	313.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_34_trimmed_1																																																			84.0%	53%	129bp	142bp	18%	294.2M	84.0%	53%	129bp	142bp	18%	294.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_34_trimmed_2																																																			84.2%	53%	129bp	142bp	18%	294.2M	84.2%	53%	129bp	142bp	18%	294.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_35	9999000000	203000254	No	0.00%	144.4bp	133.0bp	0.05%	1.25%	0.65%	0.00%	0.08%	3.45%	0.87%	0.00%	582667052	0.01%	0.65%	203659612	0.86%	0.89%	0.12%	0.11%	175669032	88984760	24837675	10824862	329.07	85.00	0.57%	0.49%	0.97	0.000				155bp	323bp	65.4%	0.0%	95.0%	89.7%	96.0%	279.8M	38.9%	96.7%	71764.7Mb	582.7M	53.9%	98.2%	59.0%
FFPE_V4_0001_RNA_0005_23KMKGLT4_35_1																																	144.4bp	95.4%	277.9M																84.7%	53%	151bp	151bp	27%	296.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_35_2																																																			83.7%	53%	151bp	151bp	27%	296.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_35_trimmed_1																																																			84.8%	53%	127bp	137bp	18%	291.3M	84.8%	53%	127bp	137bp	18%	291.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_35_trimmed_2																																																			84.8%	54%	127bp	137bp	18%	291.3M	84.8%	54%	127bp	137bp	18%	291.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_36	9999000000	179624457	No	0.00%	141.2bp	129.0bp	0.05%	1.22%	0.64%	0.00%	0.09%	3.35%	0.85%	0.00%	474331950	0.01%	0.62%	178337608	0.86%	0.89%	0.12%	0.11%	153680148	77753743	22079892	9738804	281.11	73.00	0.56%	0.47%	0.97	0.000				147bp	288bp	62.7%	0.0%	94.7%	89.5%	96.0%	227.7M	35.1%	96.8%	57808.8Mb	474.3M	53.7%	98.1%	61.6%
FFPE_V4_0001_RNA_0005_23KMKGLT4_36_1																																	141.2bp	95.2%	225.8M																83.4%	53%	151bp	151bp	27%	241.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_36_2																																																			82.2%	54%	151bp	151bp	27%	241.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_36_trimmed_1																																																			83.5%	53%	126bp	132bp	18%	237.2M	83.5%	53%	126bp	132bp	18%	237.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_36_trimmed_2																																																			83.2%	53%	126bp	132bp	18%	237.2M	83.2%	53%	126bp	132bp	18%	237.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_37	9999000000	156892599	No	0.00%	137.5bp	127.0bp	0.05%	1.19%	0.63%	0.00%	0.08%	3.28%	0.83%	0.00%	587857882	0.01%	0.72%	162126810	0.83%	0.86%	0.15%	0.14%	134714052	68127005	24127604	10897084	236.17	59.00	0.55%	0.45%	0.97	0.000				140bp	258bp	72.8%	0.0%	95.0%	89.2%	96.0%	282.0M	41.0%	96.8%	70786.1Mb	587.9M	54.1%	98.0%	64.7%
FFPE_V4_0001_RNA_0005_23KMKGLT4_37_1																																	137.5bp	95.4%	280.5M																87.2%	53%	151bp	151bp	27%	344.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_37_2																																																			85.6%	54%	151bp	151bp	27%	344.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_37_trimmed_1																																																			86.3%	53%	124bp	132bp	27%	293.9M	86.3%	53%	124bp	132bp	27%	293.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_37_trimmed_2																																																			85.7%	54%	124bp	132bp	18%	293.9M	85.7%	54%	124bp	132bp	18%	293.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_38	9999000000	170966404	No	0.00%	139.8bp	129.0bp	0.05%	1.14%	0.61%	0.00%	0.09%	3.16%	0.82%	0.00%	473547848	0.01%	0.67%	154265728	0.84%	0.87%	0.14%	0.13%	129606253	65570464	22004953	9884119	232.56	59.00	0.55%	0.45%	0.97	0.000				144bp	269bp	67.8%	0.0%	94.5%	89.6%	96.0%	227.4M	41.7%	96.8%	57701.7Mb	473.5M	53.9%	98.1%	62.5%
FFPE_V4_0001_RNA_0005_23KMKGLT4_38_1																																	139.8bp	95.1%	225.1M																84.4%	53%	151bp	151bp	27%	241.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_38_2																																																			83.1%	53%	151bp	151bp	27%	241.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_38_trimmed_1																																																			84.5%	53%	126bp	132bp	18%	236.8M	84.5%	53%	126bp	132bp	18%	236.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_38_trimmed_2																																																			84.2%	54%	126bp	132bp	18%	236.8M	84.2%	54%	126bp	132bp	18%	236.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_39	9999000000	151341201	No	0.00%	139.7bp	130.0bp	0.04%	1.15%	0.61%	0.00%	0.08%	3.18%	0.81%	0.00%	587784844	0.01%	0.72%	163903248	0.83%	0.86%	0.15%	0.14%	135662218	68611202	24914809	11265408	239.62	60.00	0.55%	0.45%	0.97	0.000				145bp	269bp	72.5%	0.0%	94.7%	89.2%	96.0%	282.1M	44.7%	96.8%	71873.2Mb	587.8M	54.0%	98.0%	62.7%
FFPE_V4_0001_RNA_0005_23KMKGLT4_39_1																																	139.7bp	95.2%	279.8M																86.3%	53%	151bp	151bp	27%	310.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_39_2																																																			84.8%	53%	151bp	151bp	27%	310.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_39_trimmed_1																																																			86.2%	53%	126bp	132bp	18%	293.9M	86.2%	53%	126bp	132bp	18%	293.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_39_trimmed_2																																																			85.7%	54%	126bp	132bp	18%	293.9M	85.7%	54%	126bp	132bp	18%	293.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_3_1																																	143.7bp	95.2%	280.8M																83.8%	56%	151bp	151bp	18%	316.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_3_2																																																			83.5%	56%	151bp	151bp	27%	316.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_3_trimmed_1																																																			83.5%	56%	127bp	137bp	9%	295.1M	83.5%	56%	127bp	137bp	9%	295.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_3_trimmed_2																																																			84.0%	57%	127bp	137bp	18%	295.1M	84.0%	57%	127bp	137bp	18%	295.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_4	9999000000	286455133	No	0.00%	139.9bp	128.0bp	0.04%	1.24%	0.67%	0.00%	0.08%	3.34%	0.88%	0.00%	589111928	0.01%	0.59%	243455851	0.88%	0.91%	0.11%	0.09%	213923433	108310319	26020355	11244423	391.24	98.00	0.58%	0.50%	0.97	0.000				144bp	265bp	59.0%	0.0%	95.0%	87.6%	95.5%	281.5M	31.9%	96.6%	71196.5Mb	589.1M	56.0%	98.2%	62.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_40	9999000000	163645745	No	0.00%	142.7bp	132.0bp	0.05%	1.11%	0.60%	0.00%	0.09%	3.08%	0.81%	0.00%	450533336	0.01%	0.66%	154621026	0.85%	0.88%	0.14%	0.12%	131029893	66306945	20983988	9352915	236.39	60.00	0.55%	0.45%	0.97	0.000				149bp	279bp	66.1%	0.0%	94.5%	89.6%	96.0%	216.3M	40.2%	96.8%	55567.1Mb	450.5M	54.2%	98.0%	60.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_40_1																																	142.7bp	95.0%	214.1M																83.6%	53%	151bp	151bp	27%	229.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_40_2																																																			82.2%	54%	151bp	151bp	27%	229.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_40_trimmed_1																																																			83.6%	54%	127bp	137bp	18%	225.3M	83.6%	54%	127bp	137bp	18%	225.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_40_trimmed_2																																																			83.4%	54%	127bp	137bp	18%	225.3M	83.4%	54%	127bp	137bp	18%	225.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_41	9999000000	283561456	No	0.00%	152.5bp	138.0bp	0.06%	1.36%	0.71%	0.00%	0.10%	3.76%	0.94%	0.00%	589164152	0.01%	0.54%	272197670	0.90%	0.93%	0.09%	0.07%	244584351	123988953	24538351	10038574	483.22	127.00	0.59%	0.52%	0.97	0.000				178bp	432bp	54.1%	0.0%	95.6%	90.2%	96.1%	283.2M	30.6%	96.8%	73817.4Mb	589.2M	53.6%	98.2%	53.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_41_1																																	152.5bp	95.8%	282.2M																84.3%	52%	151bp	151bp	27%	345.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_41_2																																																			84.1%	53%	151bp	151bp	27%	345.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_41_trimmed_1																																																			83.3%	53%	129bp	142bp	27%	294.6M	83.3%	53%	129bp	142bp	27%	294.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_41_trimmed_2																																																			84.1%	53%	130bp	142bp	18%	294.6M	84.1%	53%	130bp	142bp	18%	294.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_42	9999000000	219149334	No	0.00%	147.1bp	135.0bp	0.05%	1.30%	0.69%	0.00%	0.09%	3.60%	0.91%	0.00%	533652718	0.01%	0.60%	211845984	0.88%	0.91%	0.11%	0.09%	186574607	94485902	22398042	9535688	354.62	91.00	0.57%	0.49%	0.97	0.000				160bp	353bp	60.6%	0.0%	95.4%	89.8%	96.1%	256.3M	34.8%	96.8%	65995.4Mb	533.7M	53.9%	98.1%	57.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_42_1																																	147.1bp	95.7%	255.3M																83.7%	53%	151bp	151bp	27%	272.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_42_2																																																			82.7%	53%	151bp	151bp	27%	272.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_42_trimmed_1																																																			83.8%	53%	128bp	137bp	18%	266.8M	83.8%	53%	128bp	137bp	18%	266.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_42_trimmed_2																																																			83.8%	54%	128bp	137bp	18%	266.8M	83.8%	54%	128bp	137bp	18%	266.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_43	9999000000	194141034	No	0.00%	141.0bp	130.0bp	0.05%	1.27%	0.66%	0.00%	0.09%	3.49%	0.88%	0.00%	539278580	0.01%	0.66%	183109884	0.86%	0.89%	0.13%	0.11%	156853902	79394996	23314295	10295660	287.47	73.00	0.56%	0.47%	0.97	0.000				148bp	300bp	66.4%	0.0%	95.0%	89.8%	96.1%	259.0M	39.6%	96.9%	65661.2Mb	539.3M	53.7%	98.1%	61.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_43_1																																	141.0bp	95.4%	257.2M																85.0%	53%	151bp	151bp	27%	274.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_43_2																																																			83.7%	53%	151bp	151bp	27%	274.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_43_trimmed_1																																																			85.0%	53%	126bp	132bp	18%	269.6M	85.0%	53%	126bp	132bp	18%	269.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_43_trimmed_2																																																			84.8%	53%	126bp	132bp	18%	269.6M	84.8%	53%	126bp	132bp	18%	269.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_44	9999000000	172440871	No	0.00%	142.1bp	130.0bp	0.05%	1.20%	0.63%	0.00%	0.09%	3.33%	0.84%	0.00%	548201818	0.01%	0.66%	185480156	0.85%	0.88%	0.13%	0.12%	158433724	80180743	24002391	10621068	288.88	74.00	0.56%	0.48%	0.97	0.000				150bp	299bp	66.5%	0.0%	94.8%	89.9%	96.1%	263.3M	40.3%	96.8%	67267.3Mb	548.2M	53.7%	98.1%	60.5%
FFPE_V4_0001_RNA_0005_23KMKGLT4_44_1																																	142.1bp	95.3%	261.2M																84.9%	53%	151bp	151bp	27%	279.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_44_2																																																			83.7%	54%	151bp	151bp	27%	279.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_44_trimmed_1																																																			84.9%	53%	127bp	137bp	18%	274.1M	84.9%	53%	127bp	137bp	18%	274.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_44_trimmed_2																																																			84.8%	53%	127bp	137bp	18%	274.1M	84.8%	53%	127bp	137bp	18%	274.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_45	9999000000	180565509	No	0.00%	138.8bp	127.0bp	0.05%	1.20%	0.63%	0.00%	0.09%	3.29%	0.84%	0.00%	477235596	0.01%	0.66%	163969355	0.84%	0.87%	0.14%	0.13%	138364411	70002070	22883266	10246591	248.83	64.00	0.55%	0.46%	0.97	0.000				143bp	270bp	66.0%	0.0%	94.5%	89.4%	96.0%	229.0M	36.9%	96.7%	57743.3Mb	477.2M	53.8%	98.1%	62.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_45_1																																	138.8bp	94.9%	226.6M																84.0%	53%	151bp	151bp	27%	243.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_45_2																																																			82.9%	54%	151bp	151bp	27%	243.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_45_trimmed_1																																																			84.0%	53%	125bp	132bp	18%	238.6M	84.0%	53%	125bp	132bp	18%	238.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_45_trimmed_2																																																			83.9%	54%	125bp	132bp	18%	238.6M	83.9%	54%	125bp	132bp	18%	238.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_46	9999000000	175674568	No	0.00%	139.2bp	128.0bp	0.05%	1.19%	0.62%	0.00%	0.08%	3.26%	0.84%	0.00%	587511232	0.01%	0.70%	177227748	0.83%	0.86%	0.15%	0.14%	147574117	74659726	26225405	11777687	262.42	66.00	0.55%	0.46%	0.97	0.000				141bp	259bp	70.2%	0.0%	94.6%	88.7%	95.8%	281.4M	38.9%	96.6%	70685.8Mb	587.5M	54.3%	97.9%	63.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_46_1																																	139.2bp	95.0%	279.1M																85.7%	53%	151bp	151bp	27%	320.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_46_2																																																			84.5%	54%	151bp	151bp	27%	320.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_46_trimmed_1																																																			85.3%	54%	124bp	132bp	18%	293.8M	85.3%	54%	124bp	132bp	18%	293.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_46_trimmed_2																																																			85.2%	54%	125bp	132bp	18%	293.8M	85.2%	54%	125bp	132bp	18%	293.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_47	9999000000	194687397	No	0.00%	139.4bp	129.0bp	0.05%	1.17%	0.62%	0.00%	0.09%	3.24%	0.83%	0.00%	502019270	0.01%	0.66%	168774062	0.84%	0.87%	0.14%	0.13%	142126388	71867839	23698138	10600853	255.37	66.00	0.55%	0.46%	0.97	0.000				143bp	265bp	66.8%	0.0%	94.4%	89.3%	95.9%	240.7M	38.2%	96.7%	60923.2Mb	502.0M	54.0%	97.9%	62.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_47_1																																	139.4bp	95.0%	238.3M																84.4%	53%	151bp	151bp	27%	256.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_47_2																																																			82.8%	54%	151bp	151bp	27%	256.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_47_trimmed_1																																																			84.4%	53%	125bp	132bp	18%	251.0M	84.4%	53%	125bp	132bp	18%	251.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_47_trimmed_2																																																			84.0%	54%	126bp	132bp	18%	251.0M	84.0%	54%	126bp	132bp	18%	251.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_48	9999000000	210275973	No	0.00%	140.2bp	129.0bp	0.05%	1.17%	0.62%	0.00%	0.08%	3.23%	0.83%	0.00%	478345194	0.01%	0.64%	171371387	0.85%	0.88%	0.13%	0.12%	145645338	73647505	22878290	10148943	261.62	67.00	0.56%	0.46%	0.97	0.000				143bp	262bp	64.6%	0.0%	94.4%	88.7%	95.8%	229.1M	38.7%	96.7%	57861.1Mb	478.3M	54.4%	97.8%	62.6%
FFPE_V4_0001_RNA_0005_23KMKGLT4_48_1																																	140.2bp	94.9%	227.0M																83.5%	53%	151bp	151bp	27%	244.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_48_2																																																			82.1%	54%	151bp	151bp	27%	244.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_48_trimmed_1																																																			83.6%	54%	125bp	132bp	18%	239.2M	83.6%	54%	125bp	132bp	18%	239.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_48_trimmed_2																																																			83.3%	54%	125bp	132bp	18%	239.2M	83.3%	54%	125bp	132bp	18%	239.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_4_1																																	139.9bp	95.2%	280.4M																83.1%	55%	151bp	151bp	18%	308.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_4_2																																																			82.4%	55%	151bp	151bp	27%	308.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_4_trimmed_1																																																			82.9%	55%	125bp	132bp	9%	294.6M	82.9%	55%	125bp	132bp	9%	294.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_4_trimmed_2																																																			83.1%	56%	125bp	132bp	18%	294.6M	83.1%	56%	125bp	132bp	18%	294.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_5	9999000000	275523707	No	0.00%	140.5bp	129.0bp	0.04%	1.21%	0.65%	0.00%	0.08%	3.30%	0.86%	0.00%	589531070	0.01%	0.58%	249216308	0.88%	0.91%	0.11%	0.09%	219089683	110913380	26693358	11542104	403.12	105.00	0.58%	0.50%	0.97	0.000				147bp	272bp	58.1%	0.0%	94.9%	88.3%	95.7%	282.1M	31.5%	96.7%	71960.7Mb	589.5M	55.5%	98.3%	61.5%
FFPE_V4_0001_RNA_0005_23KMKGLT4_5_1																																	140.5bp	95.2%	280.7M																83.3%	54%	151bp	151bp	27%	324.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_5_2																																																			82.8%	55%	151bp	151bp	27%	324.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_5_trimmed_1																																																			82.7%	55%	126bp	132bp	18%	294.8M	82.7%	55%	126bp	132bp	18%	294.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_5_trimmed_2																																																			83.0%	55%	126bp	132bp	18%	294.8M	83.0%	55%	126bp	132bp	18%	294.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_6	9999000000	260748764	No	0.00%	141.3bp	131.0bp	0.05%	1.20%	0.63%	0.00%	0.08%	3.31%	0.84%	0.00%	589241760	0.01%	0.57%	254368649	0.88%	0.90%	0.11%	0.10%	222739162	112739699	28195086	12308632	410.43	112.00	0.59%	0.51%	0.97	0.000				146bp	272bp	57.2%	0.0%	94.7%	88.9%	95.8%	282.3M	32.7%	96.7%	71839.5Mb	589.2M	54.6%	98.2%	61.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_6_1																																	141.3bp	95.1%	280.0M																82.8%	53%	151bp	151bp	27%	339.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_6_2																																																			82.4%	54%	151bp	151bp	27%	339.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_6_trimmed_1																																																			81.8%	54%	126bp	132bp	27%	294.6M	81.8%	54%	126bp	132bp	27%	294.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_6_trimmed_2																																																			82.3%	54%	126bp	132bp	18%	294.6M	82.3%	54%	126bp	132bp	18%	294.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_7	9999000000	300988029	No	0.00%	140.5bp	130.0bp	0.05%	1.22%	0.63%	0.00%	0.09%	3.34%	0.85%	0.00%	589191286	0.01%	0.56%	261697192	0.88%	0.90%	0.11%	0.10%	229844644	116290632	28417837	12413981	421.83	116.00	0.59%	0.51%	0.97	0.000				144bp	267bp	55.9%	0.0%	94.7%	88.7%	95.8%	282.1M	30.7%	96.7%	71566.4Mb	589.2M	54.6%	98.2%	62.6%
FFPE_V4_0001_RNA_0005_23KMKGLT4_7_1																																	140.5bp	95.0%	280.0M																81.6%	53%	151bp	151bp	27%	312.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_7_2																																																			81.4%	54%	151bp	151bp	27%	312.7M
FFPE_V4_0001_RNA_0005_23KMKGLT4_7_trimmed_1																																																			81.3%	54%	126bp	132bp	18%	294.6M	81.3%	54%	126bp	132bp	18%	294.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_7_trimmed_2																																																			82.1%	54%	126bp	132bp	18%	294.6M	82.1%	54%	126bp	132bp	18%	294.6M
FFPE_V4_0001_RNA_0005_23KMKGLT4_8	9999000000	263694734	No	0.00%	138.4bp	127.0bp	0.05%	1.19%	0.63%	0.00%	0.10%	3.26%	0.83%	0.00%	523989056	0.01%	0.55%	235743401	0.88%	0.91%	0.11%	0.09%	207500337	104896963	25157708	10999467	375.52	103.00	0.58%	0.50%	0.97	0.000				141bp	256bp	55.3%	0.0%	94.8%	88.7%	95.8%	250.9M	29.6%	96.8%	63180.9Mb	524.0M	54.4%	98.1%	63.7%
FFPE_V4_0001_RNA_0005_23KMKGLT4_8_1																																	138.4bp	95.2%	249.4M																80.9%	53%	151bp	151bp	27%	267.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_8_2																																																			80.3%	54%	151bp	151bp	27%	267.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_8_trimmed_1																																																			81.0%	54%	125bp	132bp	18%	262.0M	81.0%	54%	125bp	132bp	18%	262.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_8_trimmed_2																																																			81.4%	54%	125bp	132bp	18%	262.0M	81.4%	54%	125bp	132bp	18%	262.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_9	9999000000	390035619	Yes	0.00%	151.9bp	139.0bp	0.06%	1.37%	0.71%	0.00%	0.10%	3.79%	0.93%	0.00%	589619734	0.01%	0.47%	313462007	0.91%	0.94%	0.08%	0.06%	285733586	144839602	24559483	9859223	570.56	156.00	0.61%	0.53%	0.97	0.000				179bp	433bp	47.1%	0.0%	95.9%	89.9%	96.1%	283.3M	25.7%	96.7%	74276.0Mb	589.6M	53.9%	98.3%	53.5%
FFPE_V4_0001_RNA_0005_23KMKGLT4_9_1																																	151.9bp	96.0%	282.9M																83.0%	53%	151bp	151bp	27%	376.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_9_2																																																			83.1%	54%	151bp	151bp	27%	376.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_9_trimmed_1																																																			81.3%	53%	130bp	147bp	27%	294.8M	81.3%	53%	130bp	147bp	27%	294.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_9_trimmed_2																																																			82.3%	54%	130bp	147bp	18%	294.8M	82.3%	54%	130bp	147bp	18%	294.8M
NTC_0001_0001_23KMKGLT4_1	9999000000	224361	Skipped	N/A%	48.1bp	31.0bp	0.01%	0.02%	0.01%	0.00%	0.01%	0.06%	0.00%	0.00%	1004444	0.16%	0.72%	277705	0.02%	0.05%	0.39%	0.95%	5598	2790	107551	51576	0.00	0.00	0.00%	0.00%	0.94	0.000				25bp	26bp	86.5%	1.8%	5.5%	1.8%	11.3%	0.1M	48.8%	91.1%	41.2Mb	1.0M	66.7%	16.2%	57.8%
NTC_0001_0001_23KMKGLT4_1_1																																	48.1bp	2.8%	0.0M																95.2%	72%	151bp	151bp	55%	3.1M
NTC_0001_0001_23KMKGLT4_1_2																																																			83.8%	92%	151bp	151bp	55%	3.1M
NTC_0001_0001_23KMKGLT4_1_trimmed_1																																																			75.1%	65%	44bp	32bp	45%	0.5M	75.1%	65%	44bp	32bp	45%	0.5M
NTC_0001_0001_23KMKGLT4_1_trimmed_2																																																			74.5%	68%	46bp	32bp	45%	0.5M	74.5%	68%	46bp	32bp	45%	0.5M
tih_rna_sample_00129_23KMKGLT4_1	9999000000	322395813	Yes	0.00%	133.6bp	125.0bp	0.06%	0.84%	0.39%	0.00%	0.14%	2.69%	0.62%	0.00%	592310670	0.01%	0.52%	282704114	0.89%	0.91%	0.10%	0.09%	251773017	127037113	26924575	11879398	460.04	241.00	0.76%	0.64%	0.97	0.000				145bp	266bp	52.6%	0.0%	95.3%	87.4%	95.3%	282.3M	32.2%	97.1%	71737.3Mb	592.3M	56.3%	98.7%	64.9%
tih_rna_sample_00129_23KMKGLT4_1_1																																	133.6bp	95.5%	283.0M																80.1%	55%	151bp	151bp	27%	314.5M
tih_rna_sample_00129_23KMKGLT4_1_2																																																			78.6%	55%	151bp	151bp	27%	314.5M
tih_rna_sample_00129_23KMKGLT4_1_trimmed_1																																																			79.9%	56%	125bp	132bp	18%	296.2M	79.9%	56%	125bp	132bp	18%	296.2M
tih_rna_sample_00129_23KMKGLT4_1_trimmed_2																																																			79.3%	56%	125bp	132bp	18%	296.2M	79.3%	56%	125bp	132bp	18%	296.2M
tih_rna_sample_00134_23KMKGLT4_1	9999000000	89706312	No	0.00%	116.9bp	111.0bp	0.05%	0.91%	0.42%	0.00%	0.11%	2.53%	0.62%	0.00%	274832564	0.02%	0.77%	63388451	0.63%	0.68%	0.30%	0.32%	39745570	20008505	19202744	9267884	58.39	19.00	0.41%	0.15%	0.96	0.000				113bp	142bp	78.2%	0.0%	88.4%	66.5%	89.0%	122.3M	39.5%	96.0%	29971.3Mb	274.8M	61.7%	97.0%	79.3%
tih_rna_sample_00134_23KMKGLT4_1_1																																	116.9bp	86.7%	119.2M																82.4%	59%	151bp	151bp	27%	141.7M
tih_rna_sample_00134_23KMKGLT4_1_2																																																			80.2%	60%	151bp	151bp	36%	141.7M
tih_rna_sample_00134_23KMKGLT4_1_trimmed_1																																																			82.3%	61%	113bp	112bp	18%	137.4M	82.3%	61%	113bp	112bp	18%	137.4M
tih_rna_sample_00134_23KMKGLT4_1_trimmed_2																																																			81.6%	61%	114bp	112bp	18%	137.4M	81.6%	61%	114bp	112bp	18%	137.4M
tih_rna_sample_00136_23KMKGLT4_1	9999000000	432843473	Yes	0.19%	137.9bp	129.0bp	0.07%	1.32%	0.32%	0.00%	0.15%	4.16%	0.52%	0.00%	592902242	0.01%	0.45%	328190382	0.88%	0.90%	0.11%	0.10%	287528706	145150879	37218544	16794397	532.55	293.00	0.78%	0.67%	0.97	0.000				141bp	232bp	44.9%	0.0%	93.6%	88.5%	95.5%	283.3M	27.2%	97.3%	72733.2Mb	592.9M	54.4%	98.8%	62.5%
tih_rna_sample_00136_23KMKGLT4_1_1																																	137.9bp	94.2%	279.2M																77.7%	53%	151bp	151bp	27%	323.0M
tih_rna_sample_00136_23KMKGLT4_1_2																																																			76.6%	54%	151bp	151bp	27%	323.0M
tih_rna_sample_00136_23KMKGLT4_1_trimmed_1																																																			77.2%	54%	126bp	132bp	18%	296.5M	77.2%	54%	126bp	132bp	18%	296.5M
tih_rna_sample_00136_23KMKGLT4_1_trimmed_2																																																			76.8%	54%	126bp	132bp	18%	296.5M	76.8%	54%	126bp	132bp	18%	296.5M
tih_rna_sample_00141_23KMKGLT4_1	9999000000	355164959	No	0.00%	139.7bp	129.0bp	0.07%	0.67%	0.47%	0.00%	0.14%	2.00%	0.67%	0.00%	592206010	0.01%	0.50%	294019741	0.90%	0.92%	0.09%	0.08%	263203741	133129062	27404131	11727427	490.03	248.00	0.75%	0.64%	0.97	0.000				145bp	273bp	50.6%	0.0%	95.2%	89.4%	95.9%	284.0M	30.9%	97.2%	72420.6Mb	592.2M	55.1%	98.7%	62.0%
tih_rna_sample_00141_23KMKGLT4_1_1																																	139.7bp	95.6%	283.1M																83.3%	54%	151bp	151bp	27%	383.3M
tih_rna_sample_00141_23KMKGLT4_1_2																																																			81.0%	55%	151bp	151bp	18%	383.3M
tih_rna_sample_00141_23KMKGLT4_1_trimmed_1																																																			81.6%	54%	126bp	132bp	18%	296.1M	81.6%	54%	126bp	132bp	18%	296.1M
tih_rna_sample_00141_23KMKGLT4_1_trimmed_2																																																			80.1%	55%	126bp	132bp	18%	296.1M	80.1%	55%	126bp	132bp	18%	296.1M
tih_rna_sample_00145_23KMKGLT4_1	9999000000	295230185	No	0.00%	122.8bp	116.0bp	0.12%	0.81%	0.42%	0.00%	0.25%	2.46%	0.66%	0.00%	592508802	0.01%	0.55%	267126143	0.87%	0.89%	0.11%	0.11%	233000381	117352216	30344067	13913025	389.49	207.00	0.74%	0.62%	0.97	0.000				127bp	214bp	55.3%	0.0%	94.6%	87.2%	95.2%	281.9M	31.7%	97.2%	68358.4Mb	592.5M	55.2%	98.8%	74.1%
tih_rna_sample_00145_23KMKGLT4_1_1																																	122.8bp	95.1%	281.7M																81.2%	54%	151bp	151bp	27%	322.0M
tih_rna_sample_00145_23KMKGLT4_1_2																																																			80.0%	55%	151bp	151bp	36%	322.0M
tih_rna_sample_00145_23KMKGLT4_1_trimmed_1																																																			80.7%	55%	119bp	122bp	18%	296.3M	80.7%	55%	119bp	122bp	18%	296.3M
tih_rna_sample_00145_23KMKGLT4_1_trimmed_2																																																			80.3%	55%	119bp	122bp	18%	296.3M	80.3%	55%	119bp	122bp	18%	296.3M
tih_rna_sample_00146_23KMKGLT4_1	9999000000	458710364	No	0.00%	149.7bp	137.0bp	0.05%	0.48%	0.36%	0.00%	0.11%	1.57%	0.56%	0.00%	592522338	0.01%	0.45%	327080181	0.90%	0.93%	0.09%	0.07%	295623614	149640552	28025420	11721202	585.68	310.00	0.77%	0.67%	0.97	0.000				171bp	359bp	45.1%	0.0%	95.1%	90.7%	96.2%	285.1M	29.1%	97.1%	75047.2Mb	592.5M	55.8%	98.8%	54.4%
tih_rna_sample_00146_23KMKGLT4_1_1																																	149.7bp	95.5%	283.0M																82.8%	54%	151bp	151bp	27%	419.3M
tih_rna_sample_00146_23KMKGLT4_1_2																																																			81.6%	55%	151bp	151bp	27%	419.3M
tih_rna_sample_00146_23KMKGLT4_1_trimmed_1																																																			80.4%	55%	130bp	142bp	18%	296.3M	80.4%	55%	130bp	142bp	18%	296.3M
tih_rna_sample_00146_23KMKGLT4_1_trimmed_2																																																			80.0%	55%	130bp	142bp	18%	296.3M	80.0%	55%	130bp	142bp	18%	296.3M
tih_rna_sample_00149_23KMKGLT4_1	9990000000	303439656	No	0.00%	125.4bp	118.0bp	0.15%	0.86%	0.33%	0.00%	0.31%	2.60%	0.52%	0.00%	506290912	0.01%	0.49%	258550820	0.86%	0.88%	0.13%	0.12%	222999698	112397597	32579560	15038504	381.04	186.00	0.73%	0.60%	0.97	0.000				125bp	193bp	49.2%	0.0%	93.2%	88.5%	95.6%	242.0M	29.9%	97.2%	58941.7Mb	506.3M	53.5%	98.8%	71.7%
tih_rna_sample_00149_23KMKGLT4_1_1																																	125.4bp	93.6%	237.0M																77.8%	52%	151bp	151bp	27%	256.3M
tih_rna_sample_00149_23KMKGLT4_1_2																																																			76.3%	53%	151bp	151bp	27%	256.3M
tih_rna_sample_00149_23KMKGLT4_1_trimmed_1																																																			77.9%	53%	120bp	122bp	18%	253.1M	77.9%	53%	120bp	122bp	18%	253.1M
tih_rna_sample_00149_23KMKGLT4_1_trimmed_2																																																			77.2%	53%	120bp	122bp	9%	253.1M	77.2%	53%	120bp	122bp	9%	253.1M
tih_rna_sample_00150_23KMKGLT4_1	9999000000	447805808	No	0.00%	135.3bp	125.0bp	0.24%	1.12%	0.48%	0.00%	0.50%	3.08%	0.65%	0.00%	593276930	0.01%	0.47%	316244805	0.89%	0.91%	0.10%	0.09%	282001750	142503956	31155930	13666991	518.92	227.00	0.73%	0.62%	0.97	0.000				139bp	290bp	46.9%	0.0%	95.1%	90.1%	96.2%	285.3M	28.2%	97.2%	71555.2Mb	593.3M	52.8%	98.9%	64.9%
tih_rna_sample_00150_23KMKGLT4_1_1																																	135.3bp	95.2%	282.4M																83.9%	52%	151bp	151bp	27%	459.1M
tih_rna_sample_00150_23KMKGLT4_1_2																																																			82.4%	52%	151bp	151bp	27%	459.1M
tih_rna_sample_00150_23KMKGLT4_1_trimmed_1																																																			81.2%	52%	124bp	132bp	18%	296.6M	81.2%	52%	124bp	132bp	18%	296.6M
tih_rna_sample_00150_23KMKGLT4_1_trimmed_2																																																			80.4%	52%	124bp	132bp	18%	296.6M	80.4%	52%	124bp	132bp	18%	296.6M
tih_rna_sample_00151_23KMKGLT4_1	9999000000	426639123	No	0.00%	146.9bp	135.0bp	0.12%	0.62%	0.42%	0.00%	0.26%	1.92%	0.60%	0.00%	592619424	0.01%	0.45%	324299890	0.90%	0.92%	0.09%	0.08%	290928844	147279811	30304265	12868996	572.17	290.00	0.74%	0.64%	0.97	0.000				162bp	345bp	45.5%	0.0%	94.8%	90.6%	96.4%	285.7M	30.5%	97.2%	74802.4Mb	592.6M	54.1%	98.8%	55.3%
tih_rna_sample_00151_23KMKGLT4_1_1																																	146.9bp	95.5%	282.8M																81.8%	53%	151bp	151bp	27%	340.3M
tih_rna_sample_00151_23KMKGLT4_1_2																																																			80.3%	54%	151bp	151bp	27%	340.3M
tih_rna_sample_00151_23KMKGLT4_1_trimmed_1																																																			80.9%	53%	130bp	142bp	18%	296.3M	80.9%	53%	130bp	142bp	18%	296.3M
tih_rna_sample_00151_23KMKGLT4_1_trimmed_2																																																			80.3%	54%	130bp	142bp	18%	296.3M	80.3%	54%	130bp	142bp	18%	296.3M
tih_rna_sample_00153_23KMKGLT4_1	9999000000	86600168	No	0.00%	106.3bp	103.0bp	0.13%	0.57%	0.34%	0.00%	0.27%	1.79%	0.53%	0.00%	314517826	0.01%	0.77%	71552452	0.63%	0.66%	0.33%	0.34%	44739875	22450715	23898612	11730545	59.33	25.00	0.46%	0.17%	0.97	0.000				104bp	125bp	78.0%	0.0%	91.1%	83.2%	94.3%	148.3M	43.0%	97.2%	32454.2Mb	314.5M	55.7%	98.5%	88.3%
tih_rna_sample_00153_23KMKGLT4_1_1																																	106.3bp	91.5%	144.0M																81.8%	54%	151bp	151bp	27%	159.6M
tih_rna_sample_00153_23KMKGLT4_1_2																																																			79.7%	55%	151bp	151bp	36%	159.6M
tih_rna_sample_00153_23KMKGLT4_1_trimmed_1																																																			81.9%	55%	106bp	107bp	18%	157.3M	81.9%	55%	106bp	107bp	18%	157.3M
tih_rna_sample_00153_23KMKGLT4_1_trimmed_2																																																			80.6%	55%	106bp	107bp	18%	157.3M	80.6%	55%	106bp	107bp	18%	157.3M
tih_rna_sample_00154_23KMKGLT4_1	9999000000	215610338	No	0.00%	143.1bp	133.0bp	0.10%	0.51%	0.23%	0.00%	0.18%	1.41%	0.33%	0.00%	554993030	0.01%	0.61%	216006236	0.86%	0.89%	0.12%	0.11%	186505614	94318900	25220457	11133948	352.74	197.00	0.76%	0.63%	0.97	0.000				158bp	328bp	61.6%	0.0%	94.6%	84.3%	93.7%	259.9M	39.8%	97.1%	69060.8Mb	555.0M	55.2%	98.5%	58.8%
tih_rna_sample_00154_23KMKGLT4_1_1																																	143.1bp	94.7%	262.8M																82.1%	54%	151bp	151bp	27%	281.8M
tih_rna_sample_00154_23KMKGLT4_1_2																																																			80.6%	55%	151bp	151bp	18%	281.8M
tih_rna_sample_00154_23KMKGLT4_1_trimmed_1																																																			82.2%	54%	128bp	137bp	18%	277.5M	82.2%	54%	128bp	137bp	18%	277.5M
tih_rna_sample_00154_23KMKGLT4_1_trimmed_2																																																			81.9%	55%	128bp	137bp	9%	277.5M	81.9%	55%	128bp	137bp	9%	277.5M
tih_rna_sample_00156_23KMKGLT4_1	9999000000	5067448	No	0.00%	120.3bp	115.0bp	0.21%	0.19%	0.11%	0.00%	0.37%	0.51%	0.18%	0.00%	50988182	0.42%	0.48%	26392576	0.13%	0.72%	0.05%	0.28%	3345469	1678013	1387806	662649	5.09	1.00	0.03%	0.01%	0.97	0.000				112bp	133bp	83.9%	0.0%	88.5%	28.6%	46.3%	11.8M	42.9%	96.4%	5444.3Mb	51.0M	59.1%	90.8%	76.5%
tih_rna_sample_00156_23KMKGLT4_1_1																																	120.3bp	47.8%	12.2M																87.4%	59%	151bp	151bp	45%	28.1M
tih_rna_sample_00156_23KMKGLT4_1_2																																																			84.3%	60%	151bp	151bp	55%	28.1M
tih_rna_sample_00156_23KMKGLT4_1_trimmed_1																																																			86.7%	58%	110bp	112bp	27%	25.5M	86.7%	58%	110bp	112bp	27%	25.5M
tih_rna_sample_00156_23KMKGLT4_1_trimmed_2																																																			85.1%	59%	111bp	112bp	18%	25.5M	85.1%	59%	111bp	112bp	18%	25.5M
tih_rna_sample_00157_23KMKGLT4_1	9999000000	291761450	No	0.00%	131.2bp	121.0bp	0.20%	1.04%	0.47%	0.00%	0.41%	3.05%	0.69%	0.00%	592048250	0.01%	0.55%	266088392	0.89%	0.91%	0.10%	0.09%	236530074	119375692	26331859	11650529	425.29	224.00	0.72%	0.62%	0.97	0.000				138bp	267bp	55.4%	0.0%	95.5%	88.9%	95.7%	283.2M	34.5%	97.1%	70709.9Mb	592.0M	54.6%	98.7%	66.5%
tih_rna_sample_00157_23KMKGLT4_1_1																																	131.2bp	95.9%	283.7M																84.5%	54%	151bp	151bp	27%	396.9M
tih_rna_sample_00157_23KMKGLT4_1_2																																																			82.8%	54%	151bp	151bp	27%	396.9M
tih_rna_sample_00157_23KMKGLT4_1_trimmed_1																																																			82.5%	54%	123bp	127bp	18%	296.0M	82.5%	54%	123bp	127bp	18%	296.0M
tih_rna_sample_00157_23KMKGLT4_1_trimmed_2																																																			81.6%	54%	123bp	127bp	18%	296.0M	81.6%	54%	123bp	127bp	18%	296.0M
tih_rna_sample_00158_23KMKGLT4_1	9999000000	290363342	No	0.00%	140.7bp	131.0bp	0.29%	1.24%	0.50%	0.00%	0.56%	3.52%	0.73%	0.00%	590802922	0.01%	0.55%	266786753	0.89%	0.92%	0.09%	0.08%	237986795	120300916	24839892	10622855	444.55	200.00	0.73%	0.61%	0.97	0.000				146bp	258bp	55.2%	0.0%	95.6%	85.7%	94.6%	279.4M	36.3%	96.9%	72628.0Mb	590.8M	58.0%	98.5%	60.9%
tih_rna_sample_00158_23KMKGLT4_1_1																																	140.7bp	95.8%	283.0M																84.2%	56%	151bp	151bp	27%	384.8M
tih_rna_sample_00158_23KMKGLT4_1_2																																																			83.0%	57%	151bp	151bp	27%	384.8M
tih_rna_sample_00158_23KMKGLT4_1_trimmed_1																																																			82.4%	57%	127bp	137bp	18%	295.4M	82.4%	57%	127bp	137bp	18%	295.4M
tih_rna_sample_00158_23KMKGLT4_1_trimmed_2																																																			82.3%	58%	127bp	137bp	18%	295.4M	82.3%	58%	127bp	137bp	18%	295.4M
tih_rna_sample_00161_23KMKGLT4_1	9999000000	251308832	No	0.00%	121.9bp	113.0bp	0.10%	0.81%	0.43%	0.00%	0.21%	2.52%	0.67%	0.00%	593082672	0.01%	0.58%	246136679	0.87%	0.89%	0.12%	0.11%	213045245	107397615	29870368	13731251	352.86	168.00	0.73%	0.59%	0.97	0.000				123bp	198bp	58.8%	0.0%	94.6%	87.7%	95.7%	283.8M	35.2%	97.3%	67537.9Mb	593.1M	55.6%	98.8%	74.5%
tih_rna_sample_00161_23KMKGLT4_1_1																																	121.9bp	95.1%	281.9M																81.8%	54%	151bp	151bp	27%	327.7M
tih_rna_sample_00161_23KMKGLT4_1_2																																																			80.1%	55%	151bp	151bp	36%	327.7M
tih_rna_sample_00161_23KMKGLT4_1_trimmed_1																																																			81.1%	55%	117bp	117bp	18%	296.5M	81.1%	55%	117bp	117bp	18%	296.5M
tih_rna_sample_00161_23KMKGLT4_1_trimmed_2																																																			80.3%	55%	117bp	117bp	18%	296.5M	80.3%	55%	117bp	117bp	18%	296.5M
tih_rna_sample_00164_23KMKGLT4_1	9999000000	76817561	No	0.00%	116.5bp	107.0bp	0.27%	0.81%	0.38%	0.00%	0.56%	2.33%	0.53%	0.00%	338845358	0.01%	0.75%	84937524	0.77%	0.82%	0.18%	0.18%	65069493	32803743	15627392	7378799	101.43	40.00	0.55%	0.28%	0.97	0.000				106bp	141bp	75.9%	0.0%	84.4%	39.6%	80.4%	136.2M	36.7%	96.8%	36010.0Mb	338.8M	57.8%	98.1%	78.9%
tih_rna_sample_00164_23KMKGLT4_1_1																																	116.5bp	81.2%	137.7M																83.8%	56%	151bp	151bp	27%	172.7M
tih_rna_sample_00164_23KMKGLT4_1_2																																																			81.7%	56%	151bp	151bp	36%	172.7M
tih_rna_sample_00164_23KMKGLT4_1_trimmed_1																																																			83.8%	57%	110bp	112bp	18%	169.4M	83.8%	57%	110bp	112bp	18%	169.4M
tih_rna_sample_00164_23KMKGLT4_1_trimmed_2																																																			82.7%	57%	110bp	112bp	18%	169.4M	82.7%	57%	110bp	112bp	18%	169.4M
tih_rna_sample_00166_23KMKGLT4_1	9999000000	218671050	No	0.00%	132.2bp	121.0bp	0.10%	0.84%	0.36%	0.00%	0.23%	2.65%	0.55%	0.00%	592772884	0.01%	0.62%	224846114	0.88%	0.90%	0.11%	0.10%	196891864	99462586	24776290	10997008	348.47	164.00	0.72%	0.59%	0.97	0.000				136bp	246bp	62.4%	0.0%	95.6%	88.6%	95.6%	283.4M	38.6%	97.3%	70877.6Mb	592.8M	55.1%	98.8%	67.0%
tih_rna_sample_00166_23KMKGLT4_1_1																																	132.2bp	96.0%	284.7M																85.9%	53%	151bp	151bp	27%	392.7M
tih_rna_sample_00166_23KMKGLT4_1_2																																																			83.5%	54%	151bp	151bp	36%	392.7M
tih_rna_sample_00166_23KMKGLT4_1_trimmed_1																																																			84.1%	54%	123bp	127bp	18%	296.4M	84.1%	54%	123bp	127bp	18%	296.4M
tih_rna_sample_00166_23KMKGLT4_1_trimmed_2																																																			82.4%	55%	123bp	127bp	18%	296.4M	82.4%	55%	123bp	127bp	18%	296.4M
tih_rna_sample_00168_23KMKGLT4_1	9999000000	209637236	No	0.00%	126.7bp	119.0bp	0.19%	1.09%	0.49%	0.00%	0.38%	3.18%	0.71%	0.00%	569751140	0.01%	0.63%	213169671	0.83%	0.86%	0.15%	0.14%	177580122	89498396	31898525	14835504	298.56	134.00	0.68%	0.55%	0.97	0.000				125bp	185bp	63.0%	0.0%	93.8%	83.1%	93.5%	266.5M	39.1%	97.2%	66571.5Mb	569.8M	55.5%	98.4%	71.3%
tih_rna_sample_00168_23KMKGLT4_1_1																																	126.7bp	94.1%	268.2M																81.6%	54%	151bp	151bp	27%	289.6M
tih_rna_sample_00168_23KMKGLT4_1_2																																																			80.0%	55%	151bp	151bp	27%	289.6M
tih_rna_sample_00168_23KMKGLT4_1_trimmed_1																																																			81.7%	55%	120bp	122bp	18%	284.9M	81.7%	55%	120bp	122bp	18%	284.9M
tih_rna_sample_00168_23KMKGLT4_1_trimmed_2																																																			81.2%	55%	120bp	122bp	9%	284.9M	81.2%	55%	120bp	122bp	9%	284.9M
tih_rna_sample_00300_23KMKGLT4_1	9999000000	53225631	No	0.00%	115.0bp	109.0bp	0.16%	0.33%	0.16%	0.00%	0.45%	1.14%	0.30%	0.00%	288443798	0.02%	0.84%	44861470	0.48%	0.56%	0.39%	0.44%	21687333	10911780	17325288	8459089	30.32	6.00	0.20%	0.06%	0.97	0.000				122bp	178bp	86.2%	0.0%	90.3%	70.3%	90.3%	130.2M	51.7%	96.3%	31396.0Mb	288.4M	65.3%	97.4%	79.8%
tih_rna_sample_00300_23KMKGLT4_1_1																																	115.0bp	89.0%	128.3M																87.8%	62%	151bp	151bp	27%	148.1M
tih_rna_sample_00300_23KMKGLT4_1_2																																																			85.0%	62%	151bp	151bp	27%	148.1M
tih_rna_sample_00300_23KMKGLT4_1_trimmed_1																																																			88.0%	65%	113bp	112bp	18%	144.2M	88.0%	65%	113bp	112bp	18%	144.2M
tih_rna_sample_00300_23KMKGLT4_1_trimmed_2																																																			86.5%	65%	113bp	112bp	18%	144.2M	86.5%	65%	113bp	112bp	18%	144.2M
tih_rna_sample_00334_23KMKGLT4_1	9999000000	327857254	No	0.00%	149.2bp	136.0bp	0.10%	1.42%	0.61%	0.00%	0.20%	4.06%	0.90%	0.00%	591715354	0.00%	0.51%	288619314	0.90%	0.92%	0.09%	0.08%	260013663	131699261	25973359	10788000	511.91	221.00	0.70%	0.60%	0.97	0.000				166bp	385bp	51.5%	0.0%	95.5%	89.9%	96.1%	284.4M	33.7%	97.0%	74272.1Mb	591.7M	54.4%	98.6%	55.7%
tih_rna_sample_00334_23KMKGLT4_1_1																																	149.2bp	96.0%	283.9M																85.2%	53%	151bp	151bp	27%	421.9M
tih_rna_sample_00334_23KMKGLT4_1_2																																																			83.4%	54%	151bp	151bp	27%	421.9M
tih_rna_sample_00334_23KMKGLT4_1_trimmed_1																																																			83.0%	54%	129bp	142bp	18%	295.9M	83.0%	54%	129bp	142bp	18%	295.9M
tih_rna_sample_00334_23KMKGLT4_1_trimmed_2																																																			82.1%	54%	129bp	142bp	18%	295.9M	82.1%	54%	129bp	142bp	18%	295.9M
tih_rna_sample_00338_23KMKGLT4_1	9999000000	58012722	No	0.00%	117.8bp	111.0bp	0.04%	0.48%	0.21%	0.00%	0.09%	1.58%	0.34%	0.00%	221518142	0.01%	0.79%	46854775	0.63%	0.67%	0.32%	0.33%	29547335	14855938	15130031	7370024	43.48	20.00	0.41%	0.11%	0.97	0.000				113bp	144bp	79.6%	0.0%	91.6%	80.4%	93.7%	103.8M	45.8%	97.1%	24419.1Mb	221.5M	57.3%	97.5%	79.0%
tih_rna_sample_00338_23KMKGLT4_1_1																																	117.8bp	91.7%	101.6M																82.7%	55%	151bp	151bp	27%	113.6M
tih_rna_sample_00338_23KMKGLT4_1_2																																																			80.3%	56%	151bp	151bp	45%	113.6M
tih_rna_sample_00338_23KMKGLT4_1_trimmed_1																																																			82.7%	57%	113bp	112bp	18%	110.8M	82.7%	57%	113bp	112bp	18%	110.8M
tih_rna_sample_00338_23KMKGLT4_1_trimmed_2																																																			81.3%	57%	114bp	112bp	9%	110.8M	81.3%	57%	114bp	112bp	9%	110.8M
tih_rna_sample_00339_23KMKGLT4_1	9999000000	373808301	No	0.00%	133.8bp	124.0bp	0.15%	0.60%	0.38%	0.00%	0.30%	1.75%	0.54%	0.00%	592379276	0.00%	0.49%	302950387	0.90%	0.93%	0.09%	0.07%	274049530	138425508	26093125	11199598	503.26	221.00	0.73%	0.61%	0.97	0.000				141bp	284bp	49.1%	0.0%	96.0%	89.9%	96.1%	284.7M	31.7%	97.1%	71246.0Mb	592.4M	55.1%	98.7%	64.8%
tih_rna_sample_00339_23KMKGLT4_1_1																																	133.8bp	96.2%	284.8M																83.4%	54%	151bp	151bp	27%	367.3M
tih_rna_sample_00339_23KMKGLT4_1_2																																																			82.1%	54%	151bp	151bp	27%	367.3M
tih_rna_sample_00339_23KMKGLT4_1_trimmed_1																																																			82.1%	54%	124bp	132bp	18%	296.2M	82.1%	54%	124bp	132bp	18%	296.2M
tih_rna_sample_00339_23KMKGLT4_1_trimmed_2																																																			81.6%	55%	124bp	132bp	18%	296.2M	81.6%	55%	124bp	132bp	18%	296.2M
tih_rna_sample_00361_23KMKGLT4_1	9999000000	302260780	Yes	0.00%	132.3bp	122.0bp	0.09%	0.75%	0.33%	0.00%	0.17%	2.21%	0.49%	0.00%	592295508	0.01%	0.53%	279668148	0.89%	0.91%	0.10%	0.09%	249157714	125761322	27474676	12137501	444.69	209.00	0.73%	0.61%	0.97	0.000				135bp	249bp	53.1%	0.0%	95.5%	89.2%	95.9%	284.0M	33.4%	97.1%	70409.9Mb	592.3M	55.4%	98.7%	67.0%
tih_rna_sample_00361_23KMKGLT4_1_1																																	132.3bp	95.7%	283.3M																81.6%	54%	151bp	151bp	27%	329.1M
tih_rna_sample_00361_23KMKGLT4_1_2																																																			79.7%	55%	151bp	151bp	27%	329.1M
tih_rna_sample_00361_23KMKGLT4_1_trimmed_1																																																			81.0%	55%	122bp	127bp	18%	296.1M	81.0%	55%	122bp	127bp	18%	296.1M
tih_rna_sample_00361_23KMKGLT4_1_trimmed_2																																																			79.9%	55%	122bp	127bp	18%	296.1M	79.9%	55%	122bp	127bp	18%	296.1M
tih_rna_sample_00427_23KMKGLT4_1	9999000000	305336988	No	0.00%	132.6bp	124.0bp	0.09%	0.59%	0.30%	0.00%	0.20%	1.96%	0.46%	0.00%	584366230	0.01%	0.54%	266770285	0.87%	0.89%	0.12%	0.11%	231899984	116958228	31161064	14173656	416.42	212.00	0.76%	0.63%	0.97	0.000				140bp	247bp	54.7%	0.0%	94.4%	87.8%	95.4%	278.8M	33.1%	97.2%	70278.1Mb	584.4M	55.7%	98.7%	66.4%
tih_rna_sample_00427_23KMKGLT4_1_1																																	132.6bp	94.8%	277.0M																80.7%	54%	151bp	151bp	27%	296.0M
tih_rna_sample_00427_23KMKGLT4_1_2																																																			79.6%	55%	151bp	151bp	27%	296.0M
tih_rna_sample_00427_23KMKGLT4_1_trimmed_1																																																			80.8%	55%	124bp	127bp	18%	292.2M	80.8%	55%	124bp	127bp	18%	292.2M
tih_rna_sample_00427_23KMKGLT4_1_trimmed_2																																																			80.6%	55%	124bp	127bp	9%	292.2M	80.6%	55%	124bp	127bp	9%	292.2M
tih_rna_sample_00430_23KMKGLT4_1	9999000000	273247719	No	0.00%	128.7bp	121.0bp	0.07%	0.76%	0.29%	0.00%	0.16%	2.34%	0.47%	0.00%	420561582	0.01%	0.47%	222826015	0.87%	0.89%	0.12%	0.11%	194095668	97846417	26205968	11988136	337.94	178.00	0.74%	0.60%	0.97	0.000				130bp	210bp	47.3%	0.0%	93.7%	88.5%	95.6%	200.9M	26.5%	97.2%	49863.6Mb	420.6M	53.9%	98.7%	69.5%
tih_rna_sample_00430_23KMKGLT4_1_1																																	128.7bp	94.1%	197.9M																75.1%	52%	151bp	151bp	27%	213.1M
tih_rna_sample_00430_23KMKGLT4_1_2																																																			73.5%	54%	151bp	151bp	27%	213.1M
tih_rna_sample_00430_23KMKGLT4_1_trimmed_1																																																			75.2%	53%	122bp	127bp	18%	210.3M	75.2%	53%	122bp	127bp	18%	210.3M
tih_rna_sample_00430_23KMKGLT4_1_trimmed_2																																																			74.4%	54%	122bp	127bp	9%	210.3M	74.4%	54%	122bp	127bp	9%	210.3M
tih_rna_sample_00434_23KMKGLT4_1	9999000000	382938440	Yes	0.00%	135.9bp	126.0bp	0.10%	1.01%	0.42%	0.00%	0.21%	3.04%	0.63%	0.00%	589663098	0.00%	0.47%	312573536	0.89%	0.91%	0.10%	0.09%	278567049	140643999	31082868	13727089	512.49	284.00	0.77%	0.66%	0.97	0.000				140bp	251bp	47.2%	0.0%	94.5%	88.5%	95.4%	281.2M	28.9%	97.3%	71901.8Mb	589.7M	54.6%	98.7%	63.3%
tih_rna_sample_00434_23KMKGLT4_1_1																																	135.9bp	95.2%	280.5M																79.1%	53%	151bp	151bp	27%	298.7M
tih_rna_sample_00434_23KMKGLT4_1_2																																																			77.8%	54%	151bp	151bp	27%	298.7M
tih_rna_sample_00434_23KMKGLT4_1_trimmed_1																																																			79.1%	54%	125bp	132bp	18%	294.8M	79.1%	54%	125bp	132bp	18%	294.8M
tih_rna_sample_00434_23KMKGLT4_1_trimmed_2																																																			78.8%	54%	125bp	132bp	9%	294.8M	78.8%	54%	125bp	132bp	9%	294.8M
tih_rna_sample_00437_23KMKGLT4_1	9999000000	263057701	Yes	0.00%	140.4bp	130.0bp	0.04%	0.92%	0.41%	0.00%	0.09%	2.83%	0.66%	0.00%	590501698	0.01%	0.58%	247386252	0.89%	0.91%	0.10%	0.09%	219982534	111090664	24017879	10426264	410.25	168.00	0.72%	0.59%	0.97	0.000				148bp	251bp	58.4%	0.0%	95.5%	85.6%	94.7%	279.5M	35.9%	96.8%	72478.3Mb	590.5M	59.2%	98.4%	61.0%
tih_rna_sample_00437_23KMKGLT4_1_1																																	140.4bp	95.9%	283.1M																83.2%	57%	151bp	151bp	27%	392.7M
tih_rna_sample_00437_23KMKGLT4_1_2																																																			82.3%	58%	151bp	151bp	27%	392.7M
tih_rna_sample_00437_23KMKGLT4_1_trimmed_1																																																			81.1%	59%	127bp	137bp	18%	295.3M	81.1%	59%	127bp	137bp	18%	295.3M
tih_rna_sample_00437_23KMKGLT4_1_trimmed_2																																																			81.4%	59%	127bp	137bp	18%	295.3M	81.4%	59%	127bp	137bp	18%	295.3M
tih_rna_sample_00440_23KMKGLT4_1	9999000000	125840529	No	0.00%	115.7bp	110.0bp	0.14%	0.30%	0.30%	0.00%	0.32%	1.00%	0.46%	0.00%	337825838	0.01%	0.65%	117098289	0.78%	0.80%	0.20%	0.20%	91249535	45870883	23182432	11127595	138.19	61.00	0.61%	0.39%	0.97	0.000				115bp	152bp	65.9%	0.0%	92.6%	83.8%	94.3%	159.3M	34.9%	97.2%	37382.3Mb	337.8M	55.9%	98.3%	80.7%
tih_rna_sample_00440_23KMKGLT4_1_1																																	115.7bp	93.0%	157.1M																77.3%	54%	151bp	151bp	27%	171.8M
tih_rna_sample_00440_23KMKGLT4_1_2																																																			75.9%	55%	151bp	151bp	36%	171.8M
tih_rna_sample_00440_23KMKGLT4_1_trimmed_1																																																			77.4%	55%	114bp	112bp	18%	168.9M	77.4%	55%	114bp	112bp	18%	168.9M
tih_rna_sample_00440_23KMKGLT4_1_trimmed_2																																																			76.8%	56%	114bp	112bp	9%	168.9M	76.8%	56%	114bp	112bp	9%	168.9M
tih_rna_sample_00441_23KMKGLT4_1	9999000000	362776443	No	0.00%	148.4bp	137.0bp	0.11%	0.98%	0.44%	0.00%	0.24%	3.11%	0.70%	0.00%	592026498	0.01%	0.49%	303024032	0.90%	0.92%	0.09%	0.08%	272117602	137746509	27698056	11676999	535.56	247.00	0.75%	0.64%	0.97	0.000				165bp	318bp	49.1%	0.0%	94.8%	88.8%	95.8%	283.7M	31.0%	97.1%	74822.2Mb	592.0M	56.7%	98.7%	54.9%
tih_rna_sample_00441_23KMKGLT4_1_1																																	148.4bp	95.4%	282.3M																80.3%	55%	151bp	151bp	27%	340.8M
tih_rna_sample_00441_23KMKGLT4_1_2																																																			79.7%	56%	151bp	151bp	27%	340.8M
tih_rna_sample_00441_23KMKGLT4_1_trimmed_1																																																			79.3%	56%	130bp	142bp	18%	296.0M	79.3%	56%	130bp	142bp	18%	296.0M
tih_rna_sample_00441_23KMKGLT4_1_trimmed_2																																																			79.6%	56%	130bp	142bp	18%	296.0M	79.6%	56%	130bp	142bp	18%	296.0M
tih_rna_sample_00450_23KMKGLT4_1	9999000000	199849895	No	0.00%	118.8bp	113.0bp	0.08%	1.01%	0.42%	0.00%	0.16%	3.02%	0.62%	0.00%	554997750	0.01%	0.63%	205879055	0.82%	0.85%	0.16%	0.15%	169199803	85123130	32138988	15198730	264.71	122.00	0.69%	0.54%	0.97	0.000				116bp	156bp	63.4%	0.0%	93.6%	85.1%	94.7%	262.8M	34.9%	97.3%	62372.0Mb	555.0M	55.7%	98.7%	78.6%
tih_rna_sample_00450_23KMKGLT4_1_1																																	118.8bp	93.8%	260.4M																79.3%	54%	151bp	151bp	27%	281.3M
tih_rna_sample_00450_23KMKGLT4_1_2																																																			78.0%	55%	151bp	151bp	36%	281.3M
tih_rna_sample_00450_23KMKGLT4_1_trimmed_1																																																			79.4%	55%	115bp	117bp	18%	277.5M	79.4%	55%	115bp	117bp	18%	277.5M
tih_rna_sample_00450_23KMKGLT4_1_trimmed_2																																																			78.9%	55%	116bp	117bp	9%	277.5M	78.9%	55%	116bp	117bp	9%	277.5M
tih_rna_sample_00451_23KMKGLT4_1	9999000000	352349772	No	0.00%	126.3bp	119.0bp	0.08%	0.61%	0.38%	0.00%	0.17%	1.85%	0.53%	0.00%	562732928	0.01%	0.48%	294055838	0.87%	0.89%	0.12%	0.11%	255919092	129036209	34391237	15696875	436.31	259.00	0.79%	0.68%	0.97	0.000				126bp	194bp	48.1%	0.0%	93.8%	87.2%	95.2%	267.7M	29.2%	97.2%	65711.3Mb	562.7M	54.5%	98.7%	71.7%
tih_rna_sample_00451_23KMKGLT4_1_1																																	126.3bp	94.3%	265.3M																77.3%	53%	151bp	151bp	27%	285.0M
tih_rna_sample_00451_23KMKGLT4_1_2																																																			75.4%	54%	151bp	151bp	27%	285.0M
tih_rna_sample_00451_23KMKGLT4_1_trimmed_1																																																			77.4%	54%	120bp	122bp	18%	281.4M	77.4%	54%	120bp	122bp	18%	281.4M
tih_rna_sample_00451_23KMKGLT4_1_trimmed_2																																																			76.3%	54%	120bp	122bp	9%	281.4M	76.3%	54%	120bp	122bp	9%	281.4M
tih_rna_sample_00453_23KMKGLT4_1	9999000000	224579146	No	0.00%	133.5bp	125.0bp	0.05%	0.58%	0.31%	0.00%	0.09%	1.72%	0.48%	0.00%	443560868	0.00%	0.54%	204858664	0.85%	0.87%	0.14%	0.13%	174228679	88019018	28751640	13154200	306.00	150.00	0.71%	0.57%	0.97	0.000				135bp	221bp	54.0%	0.0%	92.7%	89.3%	95.9%	212.7M	33.7%	97.3%	53542.3Mb	443.6M	53.9%	98.6%	66.2%
tih_rna_sample_00453_23KMKGLT4_1_1																																	133.5bp	93.8%	208.0M																78.8%	53%	151bp	151bp	27%	224.9M
tih_rna_sample_00453_23KMKGLT4_1_2																																																			77.1%	53%	151bp	151bp	27%	224.9M
tih_rna_sample_00453_23KMKGLT4_1_trimmed_1																																																			78.9%	53%	124bp	132bp	18%	221.8M	78.9%	53%	124bp	132bp	18%	221.8M
tih_rna_sample_00453_23KMKGLT4_1_trimmed_2																																																			78.0%	54%	124bp	132bp	9%	221.8M	78.0%	54%	124bp	132bp	9%	221.8M
tih_rna_sample_00457_23KMKGLT4_1	9999000000	340296140	No	0.00%	140.7bp	131.0bp	0.07%	0.60%	0.33%	0.00%	0.15%	1.93%	0.52%	0.00%	592686414	0.01%	0.51%	288820481	0.91%	0.93%	0.08%	0.07%	261562811	132160345	23876767	10119447	494.82	235.00	0.77%	0.64%	0.97	0.000				155bp	319bp	51.6%	0.0%	96.1%	89.9%	96.0%	284.6M	31.9%	97.0%	73352.5Mb	592.7M	56.1%	98.8%	60.9%
tih_rna_sample_00457_23KMKGLT4_1_1																																	140.7bp	96.4%	285.8M																83.1%	55%	151bp	151bp	27%	381.2M
tih_rna_sample_00457_23KMKGLT4_1_2																																																			81.4%	56%	151bp	151bp	27%	381.2M
tih_rna_sample_00457_23KMKGLT4_1_trimmed_1																																																			81.3%	55%	127bp	137bp	18%	296.3M	81.3%	55%	127bp	137bp	18%	296.3M
tih_rna_sample_00457_23KMKGLT4_1_trimmed_2																																																			80.4%	56%	128bp	137bp	18%	296.3M	80.4%	56%	128bp	137bp	18%	296.3M
tih_rna_sample_00460_23KMKGLT4_1	9999000000	82552209	No	0.00%	127.3bp	119.0bp	0.07%	0.45%	0.19%	0.00%	0.14%	1.48%	0.32%	0.00%	414663674	0.01%	0.82%	76703153	0.71%	0.75%	0.25%	0.25%	54411129	27382114	19387133	9258044	87.30	39.00	0.55%	0.26%	0.97	0.000				124bp	175bp	82.1%	0.0%	94.0%	85.4%	95.0%	197.0M	51.0%	96.9%	48122.0Mb	414.7M	58.1%	97.9%	71.3%
tih_rna_sample_00460_23KMKGLT4_1_1																																	127.3bp	94.2%	195.3M																85.0%	56%	151bp	151bp	27%	211.7M
tih_rna_sample_00460_23KMKGLT4_1_2																																																			82.8%	57%	151bp	151bp	27%	211.7M
tih_rna_sample_00460_23KMKGLT4_1_trimmed_1																																																			85.1%	57%	120bp	122bp	18%	207.3M	85.1%	57%	120bp	122bp	18%	207.3M
tih_rna_sample_00460_23KMKGLT4_1_trimmed_2																																																			84.1%	58%	120bp	122bp	18%	207.3M	84.1%	58%	120bp	122bp	18%	207.3M
tih_rna_sample_00461_23KMKGLT4_1	9999000000	479260207	No	0.00%	136.8bp	127.0bp	0.20%	0.93%	0.45%	0.00%	0.41%	2.68%	0.64%	0.00%	592482246	0.00%	0.43%	335588127	0.90%	0.92%	0.09%	0.08%	302979640	153105118	29694356	12783873	563.96	250.00	0.72%	0.62%	0.97	0.000				144bp	278bp	43.6%	0.0%	95.1%	88.3%	95.6%	283.2M	30.1%	97.2%	72412.2Mb	592.5M	54.3%	98.7%	62.3%
tih_rna_sample_00461_23KMKGLT4_1_1																																	136.8bp	95.7%	283.5M																84.2%	53%	151bp	151bp	27%	539.4M
tih_rna_sample_00461_23KMKGLT4_1_2																																																			83.2%	54%	151bp	151bp	27%	539.4M
tih_rna_sample_00461_23KMKGLT4_1_trimmed_1																																																			80.3%	54%	126bp	132bp	18%	296.2M	80.3%	54%	126bp	132bp	18%	296.2M
tih_rna_sample_00461_23KMKGLT4_1_trimmed_2																																																			80.1%	54%	126bp	132bp	18%	296.2M	80.1%	54%	126bp	132bp	18%	296.2M
tih_rna_sample_00462_23KMKGLT4_1	9999000000	456757176	No	0.00%	141.8bp	131.0bp	0.05%	0.68%	0.60%	0.00%	0.12%	2.10%	0.82%	0.00%	592841358	0.00%	0.46%	317586405	0.92%	0.94%	0.07%	0.06%	291731598	147371942	22970807	9528940	558.03	248.00	0.72%	0.62%	0.97	0.000				159bp	359bp	46.7%	0.0%	96.3%	91.3%	96.5%	286.0M	29.9%	97.0%	73384.5Mb	592.8M	54.9%	98.8%	60.3%
tih_rna_sample_00462_23KMKGLT4_1_1																																	141.8bp	96.6%	286.4M																84.3%	54%	151bp	151bp	27%	477.6M
tih_rna_sample_00462_23KMKGLT4_1_2																																																			83.1%	54%	151bp	151bp	27%	477.6M
tih_rna_sample_00462_23KMKGLT4_1_trimmed_1																																																			81.3%	54%	128bp	137bp	18%	296.4M	81.3%	54%	128bp	137bp	18%	296.4M
tih_rna_sample_00462_23KMKGLT4_1_trimmed_2																																																			80.9%	55%	128bp	137bp	18%	296.4M	80.9%	55%	128bp	137bp	18%	296.4M
tih_rna_sample_00464_23KMKGLT4_1	9999000000	387379402	Yes	0.00%	129.4bp	122.0bp	0.12%	1.14%	0.51%	0.00%	0.23%	3.40%	0.74%	0.00%	592678354	0.01%	0.47%	311594457	0.88%	0.91%	0.10%	0.09%	275601484	138989342	32347339	14541794	484.97	258.00	0.76%	0.65%	0.97	0.000				132bp	229bp	47.7%	0.0%	94.5%	88.7%	95.6%	283.2M	30.1%	97.2%	70334.2Mb	592.7M	53.8%	98.8%	69.0%
tih_rna_sample_00464_23KMKGLT4_1_1																																	129.4bp	95.0%	281.5M																78.4%	53%	151bp	151bp	27%	302.4M
tih_rna_sample_00464_23KMKGLT4_1_2																																																			77.1%	53%	151bp	151bp	27%	302.4M
tih_rna_sample_00464_23KMKGLT4_1_trimmed_1																																																			78.4%	53%	122bp	127bp	18%	296.3M	78.4%	53%	122bp	127bp	18%	296.3M
tih_rna_sample_00464_23KMKGLT4_1_trimmed_2																																																			77.9%	53%	122bp	127bp	9%	296.3M	77.9%	53%	122bp	127bp	9%	296.3M
tih_rna_sample_00467_23KMKGLT4_1	9999000000	277122897	Yes	0.00%	113.7bp	108.0bp	0.11%	1.26%	0.46%	0.00%	0.23%	3.70%	0.71%	0.00%	588729804	0.01%	0.56%	258968549	0.86%	0.88%	0.12%	0.12%	222270127	111784202	32121499	15034939	343.67	159.00	0.73%	0.59%	0.97	0.000				112bp	150bp	56.5%	0.0%	94.3%	83.1%	94.0%	276.7M	28.9%	97.2%	64065.2Mb	588.7M	57.4%	98.7%	81.5%
tih_rna_sample_00467_23KMKGLT4_1_1																																	113.7bp	94.5%	278.1M																79.6%	55%	151bp	151bp	27%	298.3M
tih_rna_sample_00467_23KMKGLT4_1_2																																																			77.9%	56%	151bp	151bp	36%	298.3M
tih_rna_sample_00467_23KMKGLT4_1_trimmed_1																																																			79.7%	57%	112bp	112bp	18%	294.4M	79.7%	57%	112bp	112bp	18%	294.4M
tih_rna_sample_00467_23KMKGLT4_1_trimmed_2																																																			78.9%	57%	112bp	112bp	18%	294.4M	78.9%	57%	112bp	112bp	18%	294.4M
tih_rna_sample_00473_23KMKGLT4_1	9999000000	375214491	No	0.00%	138.7bp	128.0bp	0.08%	0.64%	0.49%	0.00%	0.17%	1.93%	0.70%	0.00%	592372608	0.01%	0.50%	293832202	0.92%	0.94%	0.07%	0.06%	269282536	135924629	21535408	9020209	508.26	225.00	0.72%	0.61%	0.97	0.000				150bp	313bp	50.7%	0.0%	96.7%	89.4%	95.9%	284.0M	29.7%	97.1%	72441.0Mb	592.4M	55.0%	98.7%	62.8%
tih_rna_sample_00473_23KMKGLT4_1_1																																	138.7bp	96.6%	286.1M																84.0%	54%	151bp	151bp	36%	441.5M
tih_rna_sample_00473_23KMKGLT4_1_2																																																			82.6%	54%	151bp	151bp	27%	441.5M
tih_rna_sample_00473_23KMKGLT4_1_trimmed_1																																																			81.4%	54%	126bp	132bp	18%	296.2M	81.4%	54%	126bp	132bp	18%	296.2M
tih_rna_sample_00473_23KMKGLT4_1_trimmed_2																																																			80.8%	55%	126bp	132bp	18%	296.2M	80.8%	55%	126bp	132bp	18%	296.2M
tih_rna_sample_00475_23KMKGLT4_1	9999000000	163402579	No	0.00%	144.1bp	134.0bp	0.13%	0.50%	0.28%	0.00%	0.28%	1.63%	0.46%	0.00%	571678770	0.01%	0.72%	161577918	0.82%	0.86%	0.15%	0.14%	132231701	66909235	24000447	10833224	247.63	97.00	0.64%	0.50%	0.97	0.000				148bp	252bp	72.4%	0.0%	94.7%	85.3%	93.9%	268.3M	50.9%	97.1%	71572.1Mb	571.7M	56.3%	98.4%	58.5%
tih_rna_sample_00475_23KMKGLT4_1_1																																	144.1bp	95.3%	272.5M																85.0%	55%	151bp	151bp	27%	290.6M
tih_rna_sample_00475_23KMKGLT4_1_2																																																			83.4%	55%	151bp	151bp	27%	290.6M
tih_rna_sample_00475_23KMKGLT4_1_trimmed_1																																																			85.2%	56%	129bp	137bp	18%	285.8M	85.2%	56%	129bp	137bp	18%	285.8M
tih_rna_sample_00475_23KMKGLT4_1_trimmed_2																																																			84.7%	56%	129bp	137bp	9%	285.8M	84.7%	56%	129bp	137bp	9%	285.8M
tih_rna_sample_00476_23KMKGLT4_1	9990000000	263612506	No	0.00%	129.4bp	121.0bp	0.13%	0.74%	0.31%	0.00%	0.30%	2.38%	0.51%	0.00%	541655478	0.01%	0.56%	239581935	0.87%	0.89%	0.12%	0.11%	208229114	104991838	28244199	12889679	362.12	181.00	0.74%	0.61%	0.97	0.000				135bp	231bp	56.1%	0.0%	94.5%	88.1%	95.7%	259.0M	32.4%	97.2%	63932.0Mb	541.7M	56.3%	98.8%	69.3%
tih_rna_sample_00476_23KMKGLT4_1_1																																	129.4bp	95.0%	257.3M																79.5%	54%	151bp	151bp	27%	274.2M
tih_rna_sample_00476_23KMKGLT4_1_2																																																			77.9%	55%	151bp	151bp	27%	274.2M
tih_rna_sample_00476_23KMKGLT4_1_trimmed_1																																																			79.6%	56%	121bp	127bp	18%	270.8M	79.6%	56%	121bp	127bp	18%	270.8M
tih_rna_sample_00476_23KMKGLT4_1_trimmed_2																																																			78.8%	56%	121bp	127bp	9%	270.8M	78.8%	56%	121bp	127bp	9%	270.8M
tih_rna_sample_00479_23KMKGLT4_1	9999000000	437929722	No	0.00%	134.6bp	125.0bp	0.09%	1.18%	0.47%	0.00%	0.20%	3.65%	0.71%	0.00%	593554976	0.00%	0.49%	302807911	0.90%	0.92%	0.09%	0.08%	272332464	137519942	27699900	12084770	503.27	238.00	0.76%	0.64%	0.97	0.000				150bp	325bp	49.2%	0.0%	95.5%	89.6%	96.0%	284.8M	28.8%	97.0%	72031.3Mb	593.6M	53.7%	98.9%	64.6%
tih_rna_sample_00479_23KMKGLT4_1_1																																	134.6bp	95.9%	284.6M																82.7%	53%	151bp	151bp	27%	361.2M
tih_rna_sample_00479_23KMKGLT4_1_2																																																			81.1%	53%	151bp	151bp	27%	361.2M
tih_rna_sample_00479_23KMKGLT4_1_trimmed_1																																																			81.5%	53%	125bp	132bp	18%	296.8M	81.5%	53%	125bp	132bp	18%	296.8M
tih_rna_sample_00479_23KMKGLT4_1_trimmed_2																																																			80.6%	53%	125bp	132bp	18%	296.8M	80.6%	53%	125bp	132bp	18%	296.8M
tih_rna_sample_00480_23KMKGLT4_1	9999000000	428485060	No	0.00%	129.5bp	121.0bp	0.17%	1.04%	0.46%	0.00%	0.35%	3.13%	0.65%	0.00%	592638478	0.01%	0.46%	321176969	0.89%	0.91%	0.10%	0.09%	284765653	143535944	33004715	14932744	500.28	267.00	0.78%	0.67%	0.97	0.000				128bp	209bp	46.1%	0.0%	94.6%	88.1%	95.7%	283.5M	29.7%	97.2%	69698.4Mb	592.6M	54.2%	98.8%	69.5%
tih_rna_sample_00480_23KMKGLT4_1_1																																	129.5bp	94.9%	281.3M																82.1%	53%	151bp	151bp	27%	444.4M
tih_rna_sample_00480_23KMKGLT4_1_2																																																			80.9%	53%	151bp	151bp	27%	444.4M
tih_rna_sample_00480_23KMKGLT4_1_trimmed_1																																																			79.3%	54%	121bp	127bp	18%	296.3M	79.3%	54%	121bp	127bp	18%	296.3M
tih_rna_sample_00480_23KMKGLT4_1_trimmed_2																																																			78.8%	54%	121bp	127bp	18%	296.3M	78.8%	54%	121bp	127bp	18%	296.3M
tih_rna_sample_00481_23KMKGLT4_1	9999000000	380092701	No	0.00%	143.0bp	131.0bp	0.15%	0.83%	0.42%	0.00%	0.32%	2.52%	0.64%	0.00%	591821236	0.01%	0.48%	305840198	0.90%	0.93%	0.09%	0.07%	275563664	139307246	26442750	11218871	526.02	269.00	0.74%	0.64%	0.97	0.000				151bp	302bp	48.6%	0.0%	95.5%	86.3%	94.6%	279.8M	33.3%	97.1%	73165.5Mb	591.8M	55.1%	98.6%	59.6%
tih_rna_sample_00481_23KMKGLT4_1_1																																	143.0bp	95.8%	283.4M																83.9%	54%	151bp	151bp	27%	399.7M
tih_rna_sample_00481_23KMKGLT4_1_2																																																			82.2%	54%	151bp	151bp	27%	399.7M
tih_rna_sample_00481_23KMKGLT4_1_trimmed_1																																																			82.0%	54%	127bp	137bp	18%	295.9M	82.0%	54%	127bp	137bp	18%	295.9M
tih_rna_sample_00481_23KMKGLT4_1_trimmed_2																																																			81.2%	55%	127bp	137bp	18%	295.9M	81.2%	55%	127bp	137bp	18%	295.9M
tih_rna_sample_00482_23KMKGLT4_1	9999000000	48267271	Yes	19.20%	116.9bp	111.0bp	0.13%	0.58%	0.28%	0.00%	0.28%	1.77%	0.44%	0.00%	191474862	0.01%	0.78%	42353020	0.70%	0.75%	0.24%	0.25%	29546310	14854525	10373326	5003984	42.71	18.00	0.38%	0.10%	0.97	0.000				115bp	154bp	78.9%	0.0%	93.3%	82.6%	93.8%	89.8M	44.6%	97.1%	21140.6Mb	191.5M	56.9%	97.4%	79.4%
tih_rna_sample_00482_23KMKGLT4_1_1																																	116.9bp	93.2%	89.2M																82.1%	55%	151bp	151bp	27%	98.3M
tih_rna_sample_00482_23KMKGLT4_1_2																																																			79.6%	56%	151bp	151bp	36%	98.3M
tih_rna_sample_00482_23KMKGLT4_1_trimmed_1																																																			81.9%	56%	114bp	112bp	18%	95.7M	81.9%	56%	114bp	112bp	18%	95.7M
tih_rna_sample_00482_23KMKGLT4_1_trimmed_2																																																			80.6%	57%	114bp	112bp	9%	95.7M	80.6%	57%	114bp	112bp	9%	95.7M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Custom content: SeqTools (general stats)	Reads	SeqTools (general stats) — reads	`reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Unmapped	SeqTools (general stats) — frac unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools (general stats)	Frac Dupes	SeqTools (general stats) — frac dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools (general stats)	Unique Reads	SeqTools (general stats) — unique reads	`unique_reads`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads On Target	SeqTools (general stats) — frac reads on target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs On Target	SeqTools (general stats) — frac pairs on target	`frac_pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Reads Off Target	SeqTools (general stats) — frac reads off target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Frac Pairs Off Target	SeqTools (general stats) — frac pairs off target	`frac_pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads On Target	SeqTools (general stats) — reads on target	`reads_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs On Target	SeqTools (general stats) — pairs on target	`pairs_on_target`	None
\|\|	Custom content: SeqTools (general stats)	Reads Off Target	SeqTools (general stats) — reads off target	`reads_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Pairs Off Target	SeqTools (general stats) — pairs off target	`pairs_off_target`	None
\|\|	Custom content: SeqTools (general stats)	Mean Depth	SeqTools (general stats) — mean depth	`mean_depth`	None
\|\|	Custom content: SeqTools (general stats)	Q50 Depth	SeqTools (general stats) — q50 depth	`q50_depth`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt30X	SeqTools (general stats) — frac bases gt30x	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools (general stats)	Frac Bases Gt100X	SeqTools (general stats) — frac bases gt100x	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools (general stats)	N Q30	SeqTools (general stats) — n q30	`n_q30`	None
\|\|	Custom content: SeqTools (general stats)	GC Bias	SeqTools (general stats) — Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁹⁶/₉₆ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
FFPE_HD789_02_RNA_0011_23KMKGLT4_1	638.8M	0.0M	0.0M	45.2M	2.9M	572.9M	286.6M	286.3M	286.5M	286.4M	296.2M	276.7M	571.3M	0.0M
FFPE_V4_0001_RNA_0001_23KMKGLT4_1	640.3M	0.0M	0.0M	46.4M	3.2M	571.8M	286.0M	285.8M	285.9M	285.9M	288.7M	283.0M	569.8M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_1	672.7M	0.0M	0.0M	80.0M	3.8M	561.1M	280.6M	280.5M	280.6M	280.6M	301.6M	259.5M	560.0M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_10	633.8M	0.0M	0.0M	42.8M	3.3M	570.2M	285.3M	285.0M	285.1M	285.1M	295.4M	274.9M	568.6M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_11	635.2M	0.0M	0.0M	44.1M	3.3M	570.2M	285.3M	285.0M	285.1M	285.1M	300.3M	269.9M	568.5M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_12	633.3M	0.0M	0.0M	45.2M	3.3M	566.8M	283.6M	283.2M	283.4M	283.4M	306.3M	260.5M	565.1M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_13	635.6M	0.0M	0.0M	43.9M	3.4M	570.7M	285.5M	285.2M	285.3M	285.3M	307.6M	263.1M	569.0M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_14	606.4M	0.0M	0.0M	40.8M	3.3M	545.3M	272.8M	272.5M	272.7M	272.6M	303.2M	242.1M	543.9M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_15	634.4M	0.0M	0.0M	42.6M	3.4M	571.1M	285.7M	285.4M	285.6M	285.5M	309.0M	262.1M	569.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_16	628.6M	0.0M	0.0M	44.6M	3.4M	562.7M	281.5M	281.2M	281.4M	281.3M	310.8M	251.9M	561.1M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_17	634.8M	0.0M	0.0M	43.5M	3.2M	570.5M	285.4M	285.1M	285.3M	285.2M	287.9M	282.6M	568.7M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_18	631.7M	0.0M	0.0M	41.3M	3.2M	570.0M	285.2M	284.9M	285.0M	285.0M	298.0M	272.1M	568.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_19	637.0M	0.0M	0.0M	45.8M	3.3M	569.9M	285.1M	284.8M	285.0M	284.9M	302.7M	267.2M	568.2M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_2	657.6M	0.0M	0.0M	65.4M	3.7M	565.2M	282.7M	282.6M	282.6M	282.6M	310.2M	255.0M	563.7M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_20	636.7M	0.0M	0.0M	45.8M	3.4M	569.4M	284.8M	284.5M	284.7M	284.7M	309.1M	260.3M	567.7M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_21	598.6M	0.0M	0.0M	41.0M	3.1M	537.9M	269.1M	268.8M	268.9M	268.9M	291.6M	246.3M	536.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_22	608.5M	0.0M	0.0M	43.6M	3.2M	544.3M	272.3M	272.0M	272.2M	272.1M	298.0M	246.3M	542.6M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_23	635.2M	0.0M	0.0M	44.1M	3.4M	570.1M	285.2M	284.9M	285.0M	285.0M	307.9M	262.2M	568.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_24	636.4M	0.0M	0.0M	45.0M	3.4M	570.0M	285.2M	284.8M	285.0M	285.0M	313.1M	256.9M	568.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_25	631.1M	0.0M	0.0M	41.3M	3.1M	569.6M	284.9M	284.7M	284.8M	284.8M	289.9M	279.7M	568.0M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_26	630.8M	0.0M	0.0M	40.5M	3.2M	570.3M	285.3M	285.0M	285.2M	285.1M	292.5M	277.8M	568.5M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_27	441.7M	0.0M	0.0M	30.9M	2.2M	396.3M	198.3M	198.0M	198.2M	198.1M	209.1M	187.2M	395.1M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_28	612.6M	0.0M	0.0M	41.2M	3.1M	551.5M	275.9M	275.6M	275.8M	275.7M	295.4M	256.1M	549.9M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_29	561.4M	0.0M	0.0M	38.6M	2.9M	504.3M	252.3M	252.0M	252.2M	252.1M	274.4M	229.9M	502.8M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_3	649.0M	0.0M	0.0M	56.7M	3.5M	567.7M	283.9M	283.8M	283.9M	283.8M	313.7M	254.0M	566.2M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_30	567.7M	0.0M	0.0M	41.3M	3.0M	507.1M	253.7M	253.4M	253.6M	253.5M	279.8M	227.3M	505.7M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_31	560.2M	0.0M	0.0M	37.6M	2.8M	504.4M	252.4M	252.1M	252.2M	252.2M	274.8M	229.6M	503.1M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_32	596.6M	0.0M	0.0M	43.5M	3.2M	532.8M	266.6M	266.3M	266.4M	266.4M	293.6M	239.2M	531.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_33	633.5M	0.0M	0.0M	43.2M	3.2M	569.4M	284.8M	284.6M	284.7M	284.7M	292.4M	277.0M	567.8M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_34	632.6M	0.0M	0.0M	42.2M	3.1M	570.1M	285.2M	284.9M	285.1M	285.0M	295.4M	274.7M	568.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_35	627.3M	0.0M	0.0M	42.6M	3.2M	564.1M	282.2M	281.9M	282.1M	282.0M	301.2M	262.9M	562.5M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_36	511.6M	0.0M	0.0M	35.7M	2.6M	458.9M	229.6M	229.3M	229.5M	229.4M	250.1M	208.8M	457.6M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_37	635.7M	0.0M	0.0M	45.9M	3.3M	568.4M	284.3M	284.1M	284.2M	284.2M	314.6M	253.8M	566.9M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_38	509.9M	0.0M	0.0M	34.8M	2.7M	458.2M	229.2M	229.0M	229.1M	229.1M	253.8M	204.4M	457.0M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_39	635.3M	0.0M	0.0M	45.5M	3.3M	568.6M	284.4M	284.1M	284.3M	284.3M	313.0M	255.6M	567.0M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_4	645.8M	0.0M	0.0M	54.5M	3.5M	567.4M	283.8M	283.6M	283.7M	283.7M	316.7M	250.6M	565.8M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_40	485.3M	0.0M	0.0M	33.3M	2.6M	435.9M	218.1M	217.8M	218.0M	217.9M	240.3M	195.6M	434.7M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_41	631.4M	0.0M	0.0M	40.2M	3.1M	571.1M	285.7M	285.4M	285.6M	285.5M	290.2M	280.9M	569.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_42	573.6M	0.0M	0.0M	38.2M	2.9M	516.8M	258.6M	258.3M	258.4M	258.4M	270.7M	246.1M	515.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_43	579.8M	0.0M	0.0M	38.8M	2.9M	522.0M	261.1M	260.8M	261.0M	261.0M	281.8M	240.2M	520.6M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_44	589.1M	0.0M	0.0M	39.0M	3.0M	530.8M	265.5M	265.2M	265.4M	265.4M	287.6M	243.2M	529.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_45	514.5M	0.0M	0.0M	35.7M	2.7M	461.4M	230.8M	230.6M	230.7M	230.7M	255.4M	206.0M	460.2M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_46	637.5M	0.0M	0.0M	48.0M	3.4M	567.2M	283.7M	283.4M	283.6M	283.6M	316.8M	250.4M	565.6M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_47	541.6M	0.0M	0.0M	37.9M	2.9M	485.2M	242.8M	242.5M	242.6M	242.6M	269.1M	216.1M	483.9M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_48	518.9M	0.0M	0.0M	38.9M	2.8M	461.7M	231.0M	230.7M	230.9M	230.9M	258.0M	203.7M	460.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_5	642.4M	0.0M	0.0M	50.8M	3.4M	568.9M	284.6M	284.3M	284.5M	284.4M	315.4M	253.5M	567.2M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_6	638.8M	0.0M	0.0M	47.4M	3.4M	569.4M	284.8M	284.6M	284.7M	284.7M	315.1M	254.3M	567.8M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_7	639.7M	0.0M	0.0M	48.3M	3.4M	569.2M	284.7M	284.5M	284.6M	284.6M	316.1M	253.1M	567.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_8	569.1M	0.0M	0.0M	43.1M	3.1M	506.1M	253.2M	252.9M	253.1M	253.0M	283.5M	222.6M	504.6M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_9	634.0M	0.0M	0.0M	42.1M	3.2M	571.5M	285.9M	285.6M	285.8M	285.7M	288.6M	282.9M	569.7M	0.0M
NTC_0001_0001_23KMKGLT4_1	7.0M	0.0M	0.0M	6.0M	0.2M	0.1M	0.1M	0.1M	0.1M	0.1M	0.1M	0.0M	0.1M	0.0M
tih_rna_sample_00129_23KMKGLT4_1	650.5M	0.0M	0.0M	55.5M	4.0M	570.5M	285.4M	285.1M	285.3M	285.2M	311.1M	259.4M	568.5M	0.0M
tih_rna_sample_00134_23KMKGLT4_1	370.5M	0.0M	0.0M	93.9M	4.4M	247.6M	123.9M	123.7M	123.8M	123.8M	166.1M	81.5M	246.6M	0.0M
tih_rna_sample_00136_23KMKGLT4_1	644.1M	0.0M	0.0M	48.7M	3.4M	572.3M	286.3M	286.0M	286.2M	286.1M	334.4M	237.9M	570.3M	0.0M
tih_rna_sample_00141_23KMKGLT4_1	639.1M	0.0M	0.0M	44.6M	3.4M	573.2M	286.7M	286.5M	286.6M	286.5M	318.2M	255.0M	571.4M	0.0M
tih_rna_sample_00145_23KMKGLT4_1	651.5M	0.0M	0.0M	56.1M	3.8M	570.2M	285.3M	284.9M	285.1M	285.0M	319.8M	250.4M	568.0M	0.0M
tih_rna_sample_00146_23KMKGLT4_1	632.7M	0.0M	0.0M	37.7M	3.4M	576.1M	288.2M	287.9M	288.1M	288.0M	302.7M	273.4M	574.1M	0.0M
tih_rna_sample_00149_23KMKGLT4_1	550.5M	0.0M	0.0M	42.0M	3.0M	489.1M	244.7M	244.4M	244.6M	244.5M	290.0M	199.1M	487.3M	0.0M
tih_rna_sample_00150_23KMKGLT4_1	637.2M	0.0M	0.0M	41.5M	3.1M	576.0M	288.1M	287.9M	288.0M	288.0M	307.1M	268.9M	574.1M	0.0M
tih_rna_sample_00151_23KMKGLT4_1	634.2M	0.0M	0.0M	39.5M	3.1M	576.2M	288.2M	288.0M	288.1M	288.1M	307.5M	268.7M	574.5M	0.0M
tih_rna_sample_00153_23KMKGLT4_1	358.9M	0.0M	0.0M	42.8M	2.9M	299.8M	150.0M	149.8M	149.9M	149.9M	207.7M	92.1M	298.8M	0.0M
tih_rna_sample_00154_23KMKGLT4_1	620.4M	0.0M	0.0M	63.2M	4.3M	524.6M	262.4M	262.2M	262.3M	262.3M	281.9M	242.7M	523.0M	0.0M
tih_rna_sample_00156_23KMKGLT4_1	83.4M	0.0M	0.0M	31.9M	21.7M	24.0M	12.0M	12.0M	12.0M	12.0M	16.8M	7.2M	23.9M	0.0M
tih_rna_sample_00157_23KMKGLT4_1	640.4M	0.0M	0.0M	46.3M	3.2M	570.8M	285.5M	285.3M	285.4M	285.4M	309.3M	261.5M	569.3M	0.0M
tih_rna_sample_00158_23KMKGLT4_1	656.3M	0.0M	0.0M	63.0M	4.0M	564.2M	282.3M	281.9M	282.1M	282.1M	318.4M	245.8M	562.3M	0.0M
tih_rna_sample_00161_23KMKGLT4_1	650.8M	0.0M	0.0M	55.4M	3.2M	572.3M	286.3M	286.0M	286.2M	286.1M	332.4M	240.0M	570.7M	0.0M
tih_rna_sample_00164_23KMKGLT4_1	692.9M	0.0M	0.0M	351.0M	4.2M	275.4M	137.8M	137.6M	137.7M	137.7M	167.8M	107.6M	274.4M	0.0M
tih_rna_sample_00166_23KMKGLT4_1	643.9M	0.0M	0.0M	48.5M	3.2M	572.3M	286.2M	286.1M	286.2M	286.1M	319.5M	252.8M	570.4M	0.0M
tih_rna_sample_00168_23KMKGLT4_1	645.4M	0.0M	0.0M	73.3M	3.7M	537.9M	269.1M	268.7M	268.9M	268.9M	322.1M	215.8M	536.2M	0.0M
tih_rna_sample_00300_23KMKGLT4_1	373.6M	0.0M	0.0M	83.4M	5.8M	263.6M	132.0M	131.6M	131.8M	131.7M	161.2M	102.4M	262.5M	0.0M
tih_rna_sample_00334_23KMKGLT4_1	636.1M	0.0M	0.0M	42.3M	2.6M	573.4M	286.9M	286.6M	286.7M	286.7M	296.2M	277.2M	571.8M	0.0M
tih_rna_sample_00338_23KMKGLT4_1	259.7M	0.0M	0.0M	37.1M	2.2M	209.5M	104.9M	104.7M	104.8M	104.8M	142.0M	67.5M	208.8M	0.0M
tih_rna_sample_00339_23KMKGLT4_1	636.8M	0.0M	0.0M	42.3M	2.8M	574.2M	287.3M	287.0M	287.1M	287.1M	309.0M	265.2M	572.5M	0.0M
tih_rna_sample_00361_23KMKGLT4_1	641.2M	0.0M	0.0M	46.2M	3.0M	573.8M	287.0M	286.8M	286.9M	286.9M	317.8M	256.0M	571.8M	0.0M
tih_rna_sample_00427_23KMKGLT4_1	639.8M	0.0M	0.0M	52.8M	3.7M	563.4M	281.9M	281.5M	281.8M	281.7M	314.0M	249.4M	561.4M	0.0M
tih_rna_sample_00430_23KMKGLT4_1	457.3M	0.0M	0.0M	34.7M	2.5M	406.3M	203.2M	203.0M	203.2M	203.1M	235.8M	170.4M	404.8M	0.0M
tih_rna_sample_00434_23KMKGLT4_1	640.9M	0.0M	0.0M	48.3M	2.9M	569.3M	284.8M	284.5M	284.7M	284.6M	319.6M	249.6M	566.9M	0.0M
tih_rna_sample_00437_23KMKGLT4_1	657.0M	0.0M	0.0M	64.1M	3.4M	564.4M	282.4M	282.0M	282.2M	282.2M	321.2M	243.2M	562.5M	0.0M
tih_rna_sample_00440_23KMKGLT4_1	383.2M	0.0M	0.0M	43.6M	2.7M	322.4M	161.4M	161.1M	161.2M	161.2M	205.1M	117.3M	321.1M	0.0M
tih_rna_sample_00441_23KMKGLT4_1	643.2M	0.0M	0.0M	48.7M	3.2M	573.1M	286.7M	286.4M	286.6M	286.5M	311.3M	261.7M	571.1M	0.0M
tih_rna_sample_00450_23KMKGLT4_1	622.6M	0.0M	0.0M	64.6M	4.5M	531.7M	266.0M	265.6M	265.9M	265.8M	338.3M	193.4M	529.6M	0.0M
tih_rna_sample_00451_23KMKGLT4_1	619.0M	0.0M	0.0M	53.4M	3.7M	541.7M	271.0M	270.8M	270.9M	270.8M	320.4M	221.3M	539.6M	0.0M
tih_rna_sample_00453_23KMKGLT4_1	479.4M	0.0M	0.0M	34.1M	1.9M	429.5M	214.8M	214.6M	214.7M	214.7M	248.3M	181.2M	428.0M	0.0M
tih_rna_sample_00457_23KMKGLT4_1	638.1M	0.0M	0.0M	42.4M	3.4M	576.0M	288.1M	287.9M	288.0M	287.9M	303.1M	272.8M	573.6M	0.0M
tih_rna_sample_00460_23KMKGLT4_1	464.3M	0.0M	0.0M	47.7M	2.9M	398.0M	199.1M	198.9M	199.1M	199.0M	252.3M	145.7M	396.6M	0.0M
tih_rna_sample_00461_23KMKGLT4_1	646.0M	0.0M	0.0M	50.8M	2.9M	572.5M	286.4M	286.1M	286.3M	286.3M	310.9M	261.6M	570.4M	0.0M
tih_rna_sample_00462_23KMKGLT4_1	630.4M	0.0M	0.0M	34.9M	2.9M	577.9M	289.1M	288.8M	289.0M	288.9M	296.7M	281.3M	575.9M	0.0M
tih_rna_sample_00464_23KMKGLT4_1	643.4M	0.0M	0.0M	47.9M	3.6M	572.6M	286.5M	286.2M	286.4M	286.3M	322.1M	250.5M	570.5M	0.0M
tih_rna_sample_00467_23KMKGLT4_1	670.6M	0.0M	0.0M	79.1M	4.6M	558.9M	279.6M	279.3M	279.5M	279.4M	357.1M	201.7M	557.0M	0.0M
tih_rna_sample_00473_23KMKGLT4_1	639.4M	0.0M	0.0M	44.7M	3.0M	573.2M	286.7M	286.5M	286.6M	286.6M	301.4M	271.8M	571.4M	0.0M
tih_rna_sample_00475_23KMKGLT4_1	632.6M	0.0M	0.0M	58.8M	5.3M	541.2M	270.8M	270.4M	270.6M	270.6M	311.5M	229.7M	539.6M	0.0M
tih_rna_sample_00476_23KMKGLT4_1	591.8M	0.0M	0.0M	47.8M	3.1M	523.3M	261.8M	261.5M	261.7M	261.6M	296.6M	226.7M	521.5M	0.0M
tih_rna_sample_00479_23KMKGLT4_1	639.8M	0.0M	0.0M	43.7M	2.8M	575.4M	287.8M	287.6M	287.7M	287.6M	295.7M	279.7M	573.4M	0.0M
tih_rna_sample_00480_23KMKGLT4_1	647.4M	0.0M	0.0M	52.4M	3.4M	572.1M	286.2M	285.9M	286.1M	286.0M	331.3M	240.8M	570.3M	0.0M
tih_rna_sample_00481_23KMKGLT4_1	651.6M	0.0M	0.0M	57.8M	3.8M	564.2M	282.2M	281.9M	282.1M	282.1M	302.6M	261.5M	562.6M	0.0M
tih_rna_sample_00482_23KMKGLT4_1	219.2M	0.0M	0.0M	26.6M	2.4M	181.8M	90.9M	90.8M	90.9M	90.9M	117.3M	64.5M	181.1M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	192	158069932	0.1446%
GTCCGCGGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGA	5	532884	0.0005%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	4	43095	0.0000%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	4	45085	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	4	16521	0.0000%
GGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGAGGAGGC	4	397415	0.0004%
CCCGTCTCCGCCCCCCGGCCCCGCGTCCTCCCTCGGGAGGGCGCGCGGGT	2	386945	0.0004%
CCGAGTTGTAATTTGAAGAAGGCGACTTTGTAGCTGGTCCTTGTCTATGT	2	78099	0.0001%
ATTTGAAGAAGGCGACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAAC	2	75068	0.0001%
TTTGAAGAAGGCGACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACA	2	68765	0.0001%
GGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGT	2	64032	0.0001%
GGGGAAGCTCCGTTTCAAAGGCCTAATTTTCTAGGCCACCATCGAAAGGG	2	62526	0.0001%
CGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACG	2	61939	0.0001%
CTTTTCTTCTTAACAGCTTATCACCCCGGAATTGGTTTATCCGGAGAGGG	2	59602	0.0001%
GGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTG	2	59440	0.0001%
GCACCATCATTTCCACGAGCACCAGCAGGGCCAGGGGCTCCAGGGCGACC	2	978092	0.0009%
CTCCATTCTTTCCAGGGGGACCTGGGGGACCTCGGGGACCCATGGGACCT	2	484343	0.0004%
CATCATTTCCACGAGCACCAGCAGGGCCAGGGGCTCCAGGGCGACCTCTC	2	411357	0.0004%
GGGGCCAGCAAAGCCAGCAGGGCCGGGGGGACCAGGCTCACCACGGTCTC	2	325880	0.0003%
CCATCATTTCCACGAGCACCAGCAGGGCCAGGGGCTCCAGGGCGACCTCT	2	306078	0.0003%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

Created with MultiQC

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	55928259	0.1093%
GTCCGCGGGGCTCCGGGGGCGGGGAGCGGGGCGTGGGCGGGAGGAGGGGA	2	171368	0.0003%
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	2	21523	0.0000%
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	2	22396	0.0000%
GGCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	5779	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	6666	0.0000%
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG	2	8203	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	5422	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGTTCC	2	6717	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGG	2	5451	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGGGGGGCC	2	5897	0.0000%
CCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	2582	0.0000%
CCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	2223	0.0000%
CCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	2179	0.0000%
CCCGAGTGTTACAGCCCCCCCGGCAGCAG	2	2110	0.0000%
GCCCCCCGAGTGTTACAGCCCCCCCGGCAGCAGC	2	1785	0.0000%
AACCGAAACCGAAACCTA	2	2248	0.0000%
TAGGTTTCGGTTTCGGTT	2	2239	0.0000%
GCTGCTGCCGGGGGGGCTGTAACACTCGG	2	2205	0.0000%
GGAACCCCCGAGTGTTACAGCCCCCCCGGCAGCAG	2	1409	0.0000%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER	filter_arriba_main.py	`1.0`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CONTAMINATION_SKIPPED_LOW_READS	contamination_skipped_low_reads	`1.0.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_ALIGNMENT_CRAM	samtools	`1.17`
SAMTOOLS_INDEX_STAR_ALIGNMENT	samtools	`1.17`
SAMTOOLS_VIEW_ALIGNMENT_CRAM	samtools	`1.17`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	boto3	`unknown`
	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_ALIGNMENT	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion__2cae617--20260515-145204' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,std_run -name dev_rna_exp0001R_2cae617 --rundir 's3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260123_LH00166_0229_B23KMKGLT4/' --bclconvert_samplesheet 's3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260123_LH00166_0229_B23KMKGLT4/bclconvert_samplesheet.csv' --flowcell_id 20260123_LH00166_0229_B23KMKGLT4 --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion__2cae617--20260515-145204'

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0001R_2cae617
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,std_run
configFiles: N/A

Input/output options

outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion__2cae617--20260515-145204
rundir: s3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260123_LH00166_0229_B23KMKGLT4/
flowcell_id: 20260123_LH00166_0229_B23KMKGLT4
strand: reverse
bclconvert_samplesheet: s3://natera-platform-sandbox/pipeline-inputs/illumina_run_folders/data/20260123_LH00166_0229_B23KMKGLT4/bclconvert_samplesheet.csv
infer_sample_type_map: true
sample_type_map_positive_substring: HD789
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
starindex_ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
fastp_reads_to_process: 300000000
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks