File Info

Filename
FFPE_V4_0001_RNA_0005_23KMKGLT4_10.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion_100M__5f1fa79--20260304-094520/fastp/FFPE_V4_0001_RNA_0005_23KMKGLT4_10.fastp.log
Size
1.6 KB
Published
Mar 09, 2026 10:58 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14816666109(98.1236%)
Q30 bases: 14305590382(94.739%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14642357157(96.9693%)
Q30 bases: 13859322267(91.7836%)

Read1 after filtering:
total reads: 98211028
total bases: 12667652426
Q20 bases: 12595881013(99.4334%)
Q30 bases: 12308037554(97.1612%)

Read2 after filtering:
total reads: 98211028
total bases: 12674481075
Q20 bases: 12562675313(99.1179%)
Q30 bases: 12206433865(96.3072%)

Filtering result:
reads passed filter: 196422056
reads failed due to low quality: 2822736
reads failed due to too many N: 607404
reads failed due to too short: 147804
reads with adapter trimmed: 113012863
bases trimmed due to adapters: 4366863510

Duplication rate: 13.2938%

Insert size peak (evaluated by paired-end reads): 118

JSON report: FFPE_V4_0001_RNA_0005_23KMKGLT4_10.fastp.json
HTML report: FFPE_V4_0001_RNA_0005_23KMKGLT4_10.fastp.html

fastp --in1 FFPE_V4_0001_RNA_0005_23KMKGLT4_10_1.fastq.gz --in2 FFPE_V4_0001_RNA_0005_23KMKGLT4_10_2.fastq.gz --out1 FFPE_V4_0001_RNA_0005_23KMKGLT4_10_1.fastp.fastq.gz --out2 FFPE_V4_0001_RNA_0005_23KMKGLT4_10_2.fastp.fastq.gz --json FFPE_V4_0001_RNA_0005_23KMKGLT4_10.fastp.json --html FFPE_V4_0001_RNA_0005_23KMKGLT4_10.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 298 seconds