File Info

Filename
FFPE_V4_0001_RNA_0005_23KMKGLT4_11.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion_100M__5f1fa79--20260304-094520/fastp/FFPE_V4_0001_RNA_0005_23KMKGLT4_11.fastp.log
Size
1.6 KB
Published
Mar 09, 2026 10:58 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14888173370(98.5972%)
Q30 bases: 14392871619(95.317%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14757042316(97.7288%)
Q30 bases: 14100114115(93.3782%)

Read1 after filtering:
total reads: 98207970
total bases: 12732113401
Q20 bases: 12663291497(99.4595%)
Q30 bases: 12378984077(97.2265%)

Read2 after filtering:
total reads: 98207970
total bases: 12739247029
Q20 bases: 12621388524(99.0748%)
Q30 bases: 12249504017(96.1556%)

Filtering result:
reads passed filter: 196415940
reads failed due to low quality: 2816476
reads failed due to too many N: 616716
reads failed due to too short: 150868
reads with adapter trimmed: 112286402
bases trimmed due to adapters: 4235581488

Duplication rate: 15.8729%

Insert size peak (evaluated by paired-end reads): 119

JSON report: FFPE_V4_0001_RNA_0005_23KMKGLT4_11.fastp.json
HTML report: FFPE_V4_0001_RNA_0005_23KMKGLT4_11.fastp.html

fastp --in1 FFPE_V4_0001_RNA_0005_23KMKGLT4_11_1.fastq.gz --in2 FFPE_V4_0001_RNA_0005_23KMKGLT4_11_2.fastq.gz --out1 FFPE_V4_0001_RNA_0005_23KMKGLT4_11_1.fastp.fastq.gz --out2 FFPE_V4_0001_RNA_0005_23KMKGLT4_11_2.fastp.fastq.gz --json FFPE_V4_0001_RNA_0005_23KMKGLT4_11.fastp.json --html FFPE_V4_0001_RNA_0005_23KMKGLT4_11.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 221 seconds