File Info

Filename
FFPE_V4_0001_RNA_0005_23KMKGLT4_12.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion_100M__5f1fa79--20260304-094520/fastp/FFPE_V4_0001_RNA_0005_23KMKGLT4_12.fastp.log
Size
1.6 KB
Published
Mar 09, 2026 10:58 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14797592401(97.9973%)
Q30 bases: 14277133107(94.5506%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14589820762(96.6213%)
Q30 bases: 13856618616(91.7657%)

Read1 after filtering:
total reads: 98155852
total bases: 12486245197
Q20 bases: 12414714831(99.4271%)
Q30 bases: 12128050509(97.1313%)

Read2 after filtering:
total reads: 98155852
total bases: 12493943176
Q20 bases: 12384352667(99.1229%)
Q30 bases: 12033985814(96.3186%)

Filtering result:
reads passed filter: 196311704
reads failed due to low quality: 2854298
reads failed due to too many N: 598826
reads failed due to too short: 235172
reads with adapter trimmed: 119848621
bases trimmed due to adapters: 4717074490

Duplication rate: 15.5176%

Insert size peak (evaluated by paired-end reads): 118

JSON report: FFPE_V4_0001_RNA_0005_23KMKGLT4_12.fastp.json
HTML report: FFPE_V4_0001_RNA_0005_23KMKGLT4_12.fastp.html

fastp --in1 FFPE_V4_0001_RNA_0005_23KMKGLT4_12_1.fastq.gz --in2 FFPE_V4_0001_RNA_0005_23KMKGLT4_12_2.fastq.gz --out1 FFPE_V4_0001_RNA_0005_23KMKGLT4_12_1.fastp.fastq.gz --out2 FFPE_V4_0001_RNA_0005_23KMKGLT4_12_2.fastp.fastq.gz --json FFPE_V4_0001_RNA_0005_23KMKGLT4_12.fastp.json --html FFPE_V4_0001_RNA_0005_23KMKGLT4_12.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 282 seconds