File Info

Filename
FFPE_V4_0001_RNA_0005_23KMKGLT4_13.fastp.log
Full Path
s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion_100M__5f1fa79--20260304-094520/fastp/FFPE_V4_0001_RNA_0005_23KMKGLT4_13.fastp.log
Size
1.6 KB
Published
Mar 09, 2026 10:58 AM
Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14826318645(98.1875%)
Q30 bases: 14328010233(94.8875%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14788629437(97.9379%)
Q30 bases: 14165747723(93.8129%)

Read1 after filtering:
total reads: 98277946
total bases: 12645604673
Q20 bases: 12578013277(99.4655%)
Q30 bases: 12299564574(97.2636%)

Read2 after filtering:
total reads: 98277946
total bases: 12652820959
Q20 bases: 12537113059(99.0855%)
Q30 bases: 12169893225(96.1832%)

Filtering result:
reads passed filter: 196555892
reads failed due to low quality: 2723314
reads failed due to too many N: 606612
reads failed due to too short: 114182
reads with adapter trimmed: 115886798
bases trimmed due to adapters: 4430786185

Duplication rate: 16.911%

Insert size peak (evaluated by paired-end reads): 119

JSON report: FFPE_V4_0001_RNA_0005_23KMKGLT4_13.fastp.json
HTML report: FFPE_V4_0001_RNA_0005_23KMKGLT4_13.fastp.html

fastp --in1 FFPE_V4_0001_RNA_0005_23KMKGLT4_13_1.fastq.gz --in2 FFPE_V4_0001_RNA_0005_23KMKGLT4_13_2.fastq.gz --out1 FFPE_V4_0001_RNA_0005_23KMKGLT4_13_1.fastp.fastq.gz --out2 FFPE_V4_0001_RNA_0005_23KMKGLT4_13_2.fastp.fastq.gz --json FFPE_V4_0001_RNA_0005_23KMKGLT4_13.fastp.json --html FFPE_V4_0001_RNA_0005_23KMKGLT4_13.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 334 seconds