MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnafusion analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2026-03-09, 19:39 UTC based on data in: /tmp/nxf.bZ8JNudoK3

General Statistics

Showing ²⁴⁰/₂₄₀ rows and ⁴⁹/₅₆ columns.

Sample Name	Reads	Frac Unmapped	Unique Reads	Frac Dupes	Frac Reads On Target	Frac Reads Off Target	N Q30	Mean Depth	Q50 Depth	Frac Bases Gt30X	Frac Bases Gt100X	GC Bias	Total Reads	Expected Distinct	RNA contaminated	RNA contamination %	Fragment Length Mean	Fragment Length Median	pct Mito est. counts	pct Ribo est. counts	pct Housekeeping est. counts	pct Male est. counts	pct Mito TPM	pct Ribo TPM	pct Housekeeping TPM	pct Male TPM	Frag Length	% Aligned	M Aligned	Insert Size	Mean Insert Size	Duplication	rRNA	mRNA	% Proper Pairs	% Aligned	M Aligned	% Duplication	% > Q30	Mb Q30 bases	M Reads After Filtering	GC content	% PF	% Adapter	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
FFPE_V4_0001_RNA_0005_23KMKGLT4_1	196998046	0.01	125532914	0.36	1	0	0.97	221.44	42.00	1	0	0.000	9999000000	196393625	No	0.00%	144.5bp	132.0bp	0.04%	1.48%	0.79%	0.00%	0.06%	3.90%	1.06%	0.00%				157bp	311bp	36.6%	0.0%	95.1%	84.8%	94.5%	93.0M	17.7%	96.6%	24361.9Mb	197.0M	58.5%	98.5%	57.7%
FFPE_V4_0001_RNA_0005_23KMKGLT4_10	196422056	0.01	140882228	0.28	1	0	0.97	252.95	65.00	1	0	0.000	9999000000	313886078	No	0.00%	146.0bp	135.0bp	0.05%	1.32%	0.69%	0.00%	0.10%	3.63%	0.91%	0.00%				166bp	374bp	28.4%	0.0%	95.5%	89.7%	96.0%	94.3M	13.3%	96.7%	24514.5Mb	196.4M	53.9%	98.2%	56.5%
FFPE_V4_0001_RNA_0005_23KMKGLT4_10_1																											146.0bp	95.8%	94.0M																71.0%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_10_2																																													70.6%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_10_trimmed_1																																													71.1%	53%	129bp	142bp	18%	98.2M	71.1%	53%	129bp	142bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_10_trimmed_2																																													71.6%	54%	129bp	142bp	18%	98.2M	71.6%	54%	129bp	142bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_11	196415940	0.01	137854146	0.30	1	0	0.97	245.35	64.00	1	0	0.000	9999000000	278694064	No	0.00%	146.0bp	134.0bp	0.05%	1.23%	0.65%	0.00%	0.09%	3.40%	0.87%	0.00%				164bp	352bp	30.0%	0.0%	95.2%	89.6%	96.0%	94.3M	15.9%	96.7%	24628.5Mb	196.4M	54.2%	98.2%	56.1%
FFPE_V4_0001_RNA_0005_23KMKGLT4_11_1																											146.0bp	95.5%	93.8M																71.0%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_11_2																																													70.6%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_11_trimmed_1																																													71.1%	54%	130bp	142bp	18%	98.2M	71.1%	54%	130bp	142bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_11_trimmed_2																																													71.5%	54%	130bp	142bp	18%	98.2M	71.5%	54%	130bp	142bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_12	196311704	0.01	134415185	0.32	1	0	0.97	230.57	61.00	1	0	0.000	9999000000	261981510	No	0.00%	141.2bp	131.0bp	0.05%	1.23%	0.64%	0.00%	0.09%	3.38%	0.85%	0.00%				152bp	305bp	31.7%	0.0%	95.0%	89.3%	95.9%	94.1M	15.5%	96.7%	24162.0Mb	196.3M	54.1%	98.2%	59.9%
FFPE_V4_0001_RNA_0005_23KMKGLT4_12_1																											141.2bp	95.4%	93.6M																71.0%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_12_2																																													70.4%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_12_trimmed_1																																													71.0%	53%	127bp	137bp	18%	98.2M	71.0%	53%	127bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_12_trimmed_2																																													71.3%	54%	127bp	137bp	18%	98.2M	71.3%	54%	127bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_13	196555892	0.01	133485121	0.32	1	0	0.97	231.29	62.00	1	0	0.000	9999000000	248675771	No	0.00%	143.8bp	133.0bp	0.05%	1.19%	0.62%	0.00%	0.09%	3.30%	0.83%	0.00%				157bp	317bp	32.3%	0.0%	94.6%	89.6%	96.0%	94.3M	16.9%	96.7%	24469.5Mb	196.6M	54.0%	98.3%	57.9%
FFPE_V4_0001_RNA_0005_23KMKGLT4_13_1																											143.8bp	95.0%	93.4M																70.8%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_13_2																																													70.2%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_13_trimmed_1																																													70.8%	53%	129bp	137bp	18%	98.3M	70.8%	53%	129bp	137bp	18%	98.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_13_trimmed_2																																													71.1%	54%	129bp	137bp	18%	98.3M	71.1%	54%	129bp	137bp	18%	98.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_14	196013080	0.01	119810540	0.39	1	0	0.97	191.74	50.00	1	0	0.000	9999000000	204434011	No	0.00%	133.3bp	124.0bp	0.06%	1.20%	0.63%	0.00%	0.11%	3.32%	0.83%	0.00%				138bp	253bp	39.1%	0.0%	94.6%	89.7%	96.0%	94.1M	19.9%	96.8%	23503.8Mb	196.0M	53.3%	98.0%	65.9%
FFPE_V4_0001_RNA_0005_23KMKGLT4_14_1																											133.3bp	95.1%	93.2M																73.3%	52%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_14_2																																													70.9%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_14_trimmed_1																																													73.4%	53%	124bp	127bp	18%	98.0M	73.4%	53%	124bp	127bp	18%	98.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_14_trimmed_2																																													72.0%	53%	124bp	127bp	18%	98.0M	72.0%	53%	124bp	127bp	18%	98.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_15	196589502	0.01	132791020	0.32	1	0	0.97	227.64	61.00	1	0	0.000	9999000000	242206222	No	0.00%	142.9bp	133.0bp	0.05%	1.17%	0.61%	0.00%	0.09%	3.24%	0.82%	0.00%				154bp	303bp	32.7%	0.0%	94.6%	89.9%	96.0%	94.4M	17.5%	96.8%	24451.4Mb	196.6M	53.8%	98.3%	59.1%
FFPE_V4_0001_RNA_0005_23KMKGLT4_15_1																											142.9bp	95.1%	93.5M																70.1%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_15_2																																													69.9%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_15_trimmed_1																																													70.2%	53%	128bp	137bp	18%	98.3M	70.2%	53%	128bp	137bp	18%	98.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_15_trimmed_2																																													70.9%	54%	129bp	137bp	18%	98.3M	70.9%	54%	129bp	137bp	18%	98.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_16	196370722	0.01	132726533	0.32	1	0	0.97	221.95	59.00	1	0	0.000	9999000000	250602614	No	0.00%	138.2bp	127.0bp	0.05%	1.20%	0.62%	0.00%	0.10%	3.30%	0.83%	0.00%				146bp	277bp	32.6%	0.0%	94.6%	89.4%	95.9%	94.1M	17.2%	96.8%	23970.6Mb	196.4M	54.0%	98.2%	62.0%
FFPE_V4_0001_RNA_0005_23KMKGLT4_16_1																											138.2bp	95.0%	93.3M																69.7%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_16_2																																													69.8%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_16_trimmed_1																																													69.7%	53%	126bp	132bp	18%	98.2M	69.7%	53%	126bp	132bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_16_trimmed_2																																													70.7%	54%	126bp	132bp	18%	98.2M	70.7%	54%	126bp	132bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_17	196467054	0.01	145311703	0.26	1	0	0.97	267.23	67.00	1	0	0.000	9999000000	370739632	No	0.00%	148.9bp	136.0bp	0.06%	1.39%	0.71%	0.00%	0.10%	3.83%	0.94%	0.00%				177bp	434bp	26.2%	0.0%	95.8%	89.7%	96.0%	94.3M	12.9%	96.6%	24627.8Mb	196.5M	53.7%	98.2%	54.5%
FFPE_V4_0001_RNA_0005_23KMKGLT4_17_1																											148.9bp	95.9%	94.2M																71.4%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_17_2																																													70.5%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_17_trimmed_1																																													71.5%	53%	130bp	142bp	18%	98.2M	71.5%	53%	130bp	142bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_17_trimmed_2																																													71.4%	53%	130bp	142bp	18%	98.2M	71.4%	53%	130bp	142bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_18	196290202	0.01	134738612	0.31	1	0	0.97	234.59	61.00	1	0	0.000	9999000000	267546339	No	0.00%	142.5bp	130.0bp	0.06%	1.32%	0.69%	0.00%	0.11%	3.66%	0.90%	0.00%				156bp	348bp	31.5%	0.0%	95.5%	89.9%	96.1%	94.3M	16.2%	96.8%	24124.9Mb	196.3M	53.2%	98.1%	59.9%
FFPE_V4_0001_RNA_0005_23KMKGLT4_18_1																											142.5bp	95.8%	94.0M																72.5%	52%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_18_2																																													71.5%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_18_trimmed_1																																													72.6%	53%	127bp	137bp	18%	98.1M	72.6%	53%	127bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_18_trimmed_2																																													72.5%	53%	127bp	137bp	18%	98.1M	72.5%	53%	127bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_19	196376172	0.01	139266078	0.29	1	0	0.97	245.03	64.00	1	0	0.000	9999000000	294334838	No	0.00%	144.3bp	133.0bp	0.06%	1.24%	0.66%	0.00%	0.10%	3.44%	0.87%	0.00%				159bp	339bp	29.3%	0.0%	95.1%	89.4%	95.9%	94.2M	14.8%	96.8%	24403.0Mb	196.4M	53.9%	98.2%	57.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_19_1																											144.3bp	95.4%	93.6M																70.7%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_19_2																																													70.5%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_19_trimmed_1																																													70.8%	53%	128bp	137bp	18%	98.2M	70.8%	53%	128bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_19_trimmed_2																																													71.5%	54%	128bp	142bp	18%	98.2M	71.5%	54%	128bp	142bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_1_1																											144.5bp	94.5%	93.0M																70.8%	57%	151bp	151bp	18%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_1_2																																													73.4%	57%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_1_trimmed_1																																													70.8%	58%	128bp	137bp	9%	98.5M	70.8%	58%	128bp	137bp	9%	98.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_1_trimmed_2																																													74.0%	58%	128bp	137bp	18%	98.5M	74.0%	58%	128bp	137bp	18%	98.5M
FFPE_V4_0001_RNA_0005_23KMKGLT4_2	196714576	0.01	129955299	0.34	1	0	0.97	225.78	47.00	1	0	0.000	9999000000	227985043	No	0.00%	143.1bp	131.0bp	0.04%	1.33%	0.73%	0.00%	0.07%	3.56%	0.96%	0.00%				153bp	296bp	34.2%	0.0%	95.3%	86.8%	95.1%	93.5M	16.5%	96.6%	24170.7Mb	196.7M	57.6%	98.4%	59.0%
FFPE_V4_0001_RNA_0005_23KMKGLT4_20	196287768	0.01	134833848	0.31	1	0	0.97	229.59	61.00	1	0	0.000	9999000000	264461263	No	0.00%	140.0bp	129.0bp	0.05%	1.23%	0.65%	0.00%	0.10%	3.39%	0.86%	0.00%				150bp	300bp	31.5%	0.0%	94.9%	89.4%	95.9%	94.1M	16.4%	96.9%	24030.8Mb	196.3M	53.9%	98.1%	60.7%
FFPE_V4_0001_RNA_0005_23KMKGLT4_20_1																											140.0bp	95.3%	93.6M																71.0%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_20_2																																													70.0%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_20_trimmed_1																																													71.1%	53%	126bp	137bp	18%	98.1M	71.1%	53%	126bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_20_trimmed_2																																													71.0%	54%	126bp	137bp	18%	98.1M	71.0%	54%	126bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_21	196495632	0.01	130844455	0.33	1	0	0.97	222.56	59.00	1	0	0.000	9999000000	229875130	No	0.00%	140.7bp	130.0bp	0.05%	1.22%	0.63%	0.00%	0.10%	3.36%	0.84%	0.00%				151bp	300bp	33.6%	0.0%	94.7%	89.7%	96.0%	94.3M	17.2%	96.8%	24166.3Mb	196.5M	53.7%	98.2%	60.2%
FFPE_V4_0001_RNA_0005_23KMKGLT4_21_1																											140.7bp	95.1%	93.4M																71.2%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_21_2																																													70.9%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_21_trimmed_1																																													71.3%	53%	127bp	137bp	18%	98.2M	71.3%	53%	127bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_21_trimmed_2																																													71.9%	53%	127bp	137bp	18%	98.2M	71.9%	53%	127bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_22	196311464	0.01	132520604	0.32	1	0	0.97	223.13	60.00	1	0	0.000	9999000000	243106739	No	0.00%	139.7bp	130.0bp	0.05%	1.20%	0.62%	0.00%	0.10%	3.31%	0.83%	0.00%				148bp	285bp	32.7%	0.0%	94.7%	89.3%	95.9%	94.1M	17.8%	96.9%	24032.5Mb	196.3M	53.8%	98.2%	61.5%
FFPE_V4_0001_RNA_0005_23KMKGLT4_22_1																											139.7bp	95.2%	93.4M																70.1%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_22_2																																													69.8%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_22_trimmed_1																																													70.3%	53%	126bp	132bp	18%	98.2M	70.3%	53%	126bp	132bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_22_trimmed_2																																													70.8%	53%	126bp	137bp	18%	98.2M	70.8%	53%	126bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_23	196400138	0.01	132900106	0.32	1	0	0.97	227.28	61.00	1	0	0.000	9999000000	249522268	No	0.00%	142.5bp	132.0bp	0.05%	1.17%	0.61%	0.00%	0.09%	3.25%	0.81%	0.00%				153bp	304bp	32.5%	0.0%	94.6%	89.5%	95.9%	94.2M	17.7%	96.8%	24365.3Mb	196.4M	53.6%	98.2%	59.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_23_1																											142.5bp	95.2%	93.5M																70.8%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_23_2																																													69.8%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_23_trimmed_1																																													70.9%	53%	128bp	137bp	18%	98.2M	70.9%	53%	128bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_23_trimmed_2																																													70.8%	53%	128bp	137bp	18%	98.2M	70.8%	53%	128bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_24	196486172	0.01	133261346	0.32	1	0	0.97	224.45	60.00	1	0	0.000	9999000000	250909869	No	0.00%	140.1bp	130.0bp	0.05%	1.19%	0.61%	0.00%	0.10%	3.29%	0.82%	0.00%				149bp	285bp	32.4%	0.0%	94.4%	89.4%	95.9%	94.2M	17.1%	96.8%	24076.1Mb	196.5M	53.7%	98.2%	61.0%
FFPE_V4_0001_RNA_0005_23KMKGLT4_24_1																											140.1bp	95.0%	93.3M																70.0%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_24_2																																													69.9%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_24_trimmed_1																																													70.1%	53%	127bp	137bp	18%	98.2M	70.1%	53%	127bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_24_trimmed_2																																													70.8%	53%	127bp	137bp	18%	98.2M	70.8%	53%	127bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_25	196096120	0.01	132854805	0.32	1	0	0.97	239.60	58.00	1	0	0.000	9999000000	247085903	No	0.00%	146.7bp	134.0bp	0.05%	1.36%	0.72%	0.00%	0.08%	3.74%	0.94%	0.00%				171bp	404bp	32.4%	0.0%	95.9%	89.9%	96.1%	94.2M	18.0%	96.8%	24493.6Mb	196.1M	54.2%	98.0%	56.0%
FFPE_V4_0001_RNA_0005_23KMKGLT4_25_1																											146.7bp	96.1%	94.2M																72.5%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_25_2																																													71.7%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_25_trimmed_1																																													72.6%	53%	129bp	142bp	18%	98.0M	72.6%	53%	129bp	142bp	18%	98.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_25_trimmed_2																																													72.9%	54%	129bp	142bp	18%	98.0M	72.9%	54%	129bp	142bp	18%	98.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_26	196161936	0.01	129152062	0.34	1	0	0.97	234.14	60.00	1	0	0.000	9999000000	215494272	No	0.00%	150.7bp	137.0bp	0.05%	1.27%	0.66%	0.00%	0.08%	3.54%	0.89%	0.00%				177bp	416bp	34.4%	0.0%	95.2%	90.1%	96.1%	94.3M	18.6%	96.7%	24784.5Mb	196.2M	53.6%	98.1%	53.3%
FFPE_V4_0001_RNA_0005_23KMKGLT4_26_1																											150.7bp	95.5%	93.7M																72.0%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_26_2																																													71.4%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_26_trimmed_1																																													72.1%	53%	131bp	147bp	18%	98.1M	72.1%	53%	131bp	147bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_26_trimmed_2																																													72.6%	53%	131bp	147bp	18%	98.1M	72.6%	53%	131bp	147bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_27	196244320	0.01	122085194	0.38	1	0	0.97	213.04	55.00	1	0	0.000	9999000000	182333385	No	0.00%	147.2bp	135.0bp	0.05%	1.22%	0.64%	0.00%	0.08%	3.40%	0.85%	0.00%				162bp	349bp	38.0%	0.0%	94.9%	89.4%	96.0%	94.2M	20.3%	96.7%	24506.6Mb	196.2M	53.9%	98.1%	56.6%
FFPE_V4_0001_RNA_0005_23KMKGLT4_27_1																											147.2bp	95.3%	93.5M																72.2%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_27_2																																													71.6%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_27_trimmed_1																																													72.2%	53%	129bp	142bp	18%	98.1M	72.2%	53%	129bp	142bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_27_trimmed_2																																													72.5%	54%	129bp	142bp	18%	98.1M	72.5%	54%	129bp	142bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_28	196300066	0.01	117677107	0.40	1	0	0.97	200.29	52.00	1	0	0.000	9990000000	158419454	No	0.00%	143.9bp	133.0bp	0.04%	1.20%	0.62%	0.00%	0.08%	3.34%	0.83%	0.00%				156bp	324bp	40.3%	0.0%	94.7%	89.7%	96.0%	94.2M	21.5%	96.8%	24337.0Mb	196.3M	53.5%	98.2%	58.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_28_1																											143.9bp	95.2%	93.4M																72.7%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_28_2																																													71.9%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_28_trimmed_1																																													72.8%	53%	128bp	137bp	18%	98.2M	72.8%	53%	128bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_28_trimmed_2																																													73.0%	53%	128bp	137bp	18%	98.2M	73.0%	53%	128bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_29	196103232	0.01	113597143	0.42	1	0	0.97	189.20	49.00	1	0	0.000	9999000000	145966608	No	0.00%	141.4bp	130.0bp	0.05%	1.19%	0.62%	0.00%	0.09%	3.29%	0.82%	0.00%				151bp	298bp	42.3%	0.0%	94.6%	89.6%	96.0%	94.1M	22.4%	96.7%	24097.7Mb	196.1M	53.6%	98.1%	60.2%
FFPE_V4_0001_RNA_0005_23KMKGLT4_29_1																											141.4bp	95.1%	93.2M																73.1%	52%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_29_2																																													71.9%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_29_trimmed_1																																													73.1%	53%	127bp	137bp	18%	98.1M	73.1%	53%	127bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_29_trimmed_2																																													73.0%	53%	127bp	137bp	18%	98.1M	73.0%	53%	127bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_2_1																											143.1bp	95.1%	93.5M																69.1%	56%	151bp	151bp	18%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_2_2																																													70.4%	57%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_2_trimmed_1																																													69.1%	57%	127bp	137bp	9%	98.4M	69.1%	57%	127bp	137bp	9%	98.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_2_trimmed_2																																													71.1%	57%	127bp	137bp	18%	98.4M	71.1%	57%	127bp	137bp	18%	98.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_3	196780288	0.01	126681666	0.36	1	0	0.97	216.75	47.00	1	0	0.000	9999000000	209952953	No	0.00%	142.1bp	131.0bp	0.04%	1.26%	0.70%	0.00%	0.07%	3.39%	0.92%	0.00%				151bp	287bp	35.9%	0.0%	95.1%	87.9%	95.5%	93.9M	18.2%	96.7%	24163.2Mb	196.8M	56.9%	98.4%	59.7%
FFPE_V4_0001_RNA_0005_23KMKGLT4_30	196184652	0.01	103145713	0.47	1	0	0.97	165.83	42.00	1	0	0.000	9999000000	121124266	No	0.00%	138.4bp	128.0bp	0.04%	1.17%	0.62%	0.00%	0.08%	3.24%	0.82%	0.00%				145bp	273bp	47.7%	0.0%	94.6%	89.2%	95.9%	94.1M	26.4%	96.7%	23843.0Mb	196.2M	54.0%	98.1%	62.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_30_1																											138.4bp	95.1%	93.3M																73.9%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_30_2																																													72.4%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_30_trimmed_1																																													74.0%	53%	126bp	132bp	18%	98.1M	74.0%	53%	126bp	132bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_30_trimmed_2																																													73.5%	54%	126bp	132bp	18%	98.1M	73.5%	54%	126bp	132bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_31	196225608	0.01	107052014	0.45	1	0	0.97	175.83	45.00	1	0	0.000	9999000000	139014430	No	0.00%	141.6bp	131.0bp	0.04%	1.15%	0.61%	0.00%	0.08%	3.20%	0.82%	0.00%				150bp	289bp	45.7%	0.0%	94.6%	89.9%	96.1%	94.3M	26.2%	96.8%	24192.6Mb	196.2M	53.7%	98.1%	60.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_31_1																											141.6bp	95.1%	93.3M																73.6%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_31_2																																													72.5%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_31_trimmed_1																																													73.7%	53%	127bp	137bp	18%	98.1M	73.7%	53%	127bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_31_trimmed_2																																													73.5%	53%	127bp	137bp	18%	98.1M	73.5%	53%	127bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_32	196140366	0.01	108404798	0.45	1	0	0.97	176.57	45.00	1	0	0.000	9999000000	129194768	No	0.00%	140.4bp	130.0bp	0.04%	1.15%	0.60%	0.00%	0.08%	3.19%	0.81%	0.00%				148bp	280bp	45.0%	0.0%	94.3%	89.2%	95.9%	94.0M	24.4%	96.8%	24066.8Mb	196.1M	53.9%	98.1%	61.2%
FFPE_V4_0001_RNA_0005_23KMKGLT4_32_1																											140.4bp	94.8%	93.0M																72.7%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_32_2																																													72.0%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_32_trimmed_1																																													72.8%	53%	127bp	137bp	18%	98.1M	72.8%	53%	127bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_32_trimmed_2																																													73.0%	54%	127bp	137bp	18%	98.1M	73.0%	54%	127bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_33	196298254	0.01	133581941	0.32	1	0	0.97	239.36	59.00	1	0	0.000	9999000000	245821444	No	0.00%	146.1bp	133.0bp	0.05%	1.38%	0.72%	0.00%	0.09%	3.77%	0.95%	0.00%				168bp	394bp	32.1%	0.0%	95.8%	89.6%	96.0%	94.2M	16.2%	96.7%	24322.4Mb	196.3M	54.1%	98.1%	56.6%
FFPE_V4_0001_RNA_0005_23KMKGLT4_33_1																											146.1bp	96.0%	94.2M																72.1%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_33_2																																													71.4%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_33_trimmed_1																																													72.2%	53%	128bp	142bp	18%	98.1M	72.2%	53%	128bp	142bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_33_trimmed_2																																													72.5%	54%	128bp	142bp	18%	98.1M	72.5%	54%	128bp	142bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_34	196184532	0.01	127063281	0.35	1	0	0.97	225.88	57.00	1	0	0.000	9999000000	210782432	No	0.00%	147.0bp	134.0bp	0.05%	1.29%	0.67%	0.00%	0.09%	3.58%	0.89%	0.00%				167bp	382bp	35.4%	0.0%	95.4%	89.8%	96.1%	94.2M	19.1%	96.8%	24493.1Mb	196.2M	53.7%	98.1%	56.0%
FFPE_V4_0001_RNA_0005_23KMKGLT4_34_1																											147.0bp	95.6%	93.8M																72.5%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_34_2																																													71.5%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_34_trimmed_1																																													72.5%	53%	129bp	142bp	18%	98.1M	72.5%	53%	129bp	142bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_34_trimmed_2																																													72.6%	53%	129bp	142bp	18%	98.1M	72.6%	53%	129bp	142bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_35	196313786	0.01	117450226	0.40	1	0	0.97	200.42	51.00	1	0	0.000	9999000000	160831390	No	0.00%	142.3bp	130.0bp	0.05%	1.25%	0.65%	0.00%	0.08%	3.45%	0.87%	0.00%				155bp	327bp	40.4%	0.0%	95.0%	89.7%	96.0%	94.3M	21.8%	96.7%	24179.1Mb	196.3M	53.9%	98.2%	59.0%
FFPE_V4_0001_RNA_0005_23KMKGLT4_35_1																											142.3bp	95.4%	93.6M																73.3%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_35_2																																													72.4%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_35_trimmed_1																																													73.3%	53%	127bp	137bp	18%	98.2M	73.3%	53%	127bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_35_trimmed_2																																													73.3%	54%	127bp	137bp	18%	98.2M	73.3%	54%	127bp	137bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_36	196218416	0.01	113645403	0.42	1	0	0.97	187.76	48.00	1	0	0.000	9999000000	145924946	No	0.00%	139.3bp	128.0bp	0.05%	1.22%	0.64%	0.00%	0.09%	3.36%	0.85%	0.00%				148bp	292bp	42.3%	0.0%	94.7%	89.5%	96.0%	94.2M	21.9%	96.8%	23913.9Mb	196.2M	53.7%	98.1%	61.6%
FFPE_V4_0001_RNA_0005_23KMKGLT4_36_1																											139.3bp	95.2%	93.4M																73.9%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_36_2																																													72.6%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_36_trimmed_1																																													74.0%	53%	126bp	132bp	18%	98.1M	74.0%	53%	126bp	132bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_36_trimmed_2																																													73.7%	53%	126bp	132bp	18%	98.1M	73.7%	53%	126bp	132bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_37	196054408	0.01	101526662	0.48	1	0	0.97	160.98	40.00	1	0	0.000	9999000000	116892717	No	0.00%	135.3bp	126.0bp	0.05%	1.19%	0.63%	0.00%	0.08%	3.28%	0.83%	0.00%				141bp	262bp	48.5%	0.0%	95.0%	89.3%	95.9%	94.0M	25.3%	96.8%	23622.1Mb	196.1M	54.1%	98.0%	64.7%
FFPE_V4_0001_RNA_0005_23KMKGLT4_37_1																											135.3bp	95.4%	93.5M																75.4%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_37_2																																													73.5%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_37_trimmed_1																																													75.4%	53%	124bp	132bp	18%	98.0M	75.4%	53%	124bp	132bp	18%	98.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_37_trimmed_2																																													74.6%	54%	124bp	132bp	18%	98.0M	74.6%	54%	124bp	132bp	18%	98.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_38	196228006	0.01	103142711	0.47	1	0	0.97	165.59	42.00	1	0	0.000	9999000000	118555510	No	0.00%	138.4bp	128.0bp	0.05%	1.14%	0.61%	0.00%	0.09%	3.17%	0.82%	0.00%				145bp	271bp	47.7%	0.0%	94.5%	89.6%	96.0%	94.2M	27.2%	96.8%	23910.2Mb	196.2M	53.9%	98.1%	62.5%
FFPE_V4_0001_RNA_0005_23KMKGLT4_38_1																											138.4bp	95.1%	93.3M																75.0%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_38_2																																													73.4%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_38_trimmed_1																																													75.1%	53%	126bp	132bp	18%	98.1M	75.1%	53%	126bp	132bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_38_trimmed_2																																													74.5%	54%	126bp	132bp	18%	98.1M	74.5%	54%	126bp	132bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_39	195952144	0.01	101937753	0.48	1	0	0.97	162.88	41.00	1	0	0.000	9999000000	112322869	No	0.00%	138.0bp	128.0bp	0.04%	1.15%	0.61%	0.00%	0.08%	3.17%	0.81%	0.00%				145bp	271bp	48.3%	0.0%	94.7%	89.3%	95.9%	94.0M	27.2%	96.9%	23966.3Mb	196.0M	54.0%	98.0%	62.7%
FFPE_V4_0001_RNA_0005_23KMKGLT4_39_1																											138.0bp	95.2%	93.3M																74.8%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_39_2																																													73.0%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_39_trimmed_1																																													74.8%	53%	126bp	132bp	18%	98.0M	74.8%	53%	126bp	132bp	18%	98.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_39_trimmed_2																																													74.2%	54%	126bp	132bp	18%	98.0M	74.2%	54%	126bp	132bp	18%	98.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_3_1																											142.1bp	95.1%	93.6M																71.3%	56%	151bp	151bp	18%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_3_2																																													71.8%	56%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_3_trimmed_1																																													71.4%	56%	127bp	137bp	9%	98.4M	71.4%	56%	127bp	137bp	9%	98.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_3_trimmed_2																																													72.6%	57%	127bp	137bp	18%	98.4M	72.6%	57%	127bp	137bp	18%	98.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_4	196396000	0.01	129196152	0.34	1	0	0.97	215.89	51.00	1	0	0.000	9999000000	227320516	No	0.00%	137.8bp	127.0bp	0.04%	1.23%	0.67%	0.00%	0.08%	3.33%	0.89%	0.00%				145bp	269bp	34.5%	0.0%	95.0%	88.3%	95.6%	93.8M	16.7%	96.6%	23743.5Mb	196.4M	56.0%	98.2%	62.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_40	196042990	0.01	104544916	0.47	1	0	0.97	169.68	43.00	1	0	0.000	9999000000	114343537	No	0.00%	141.2bp	130.0bp	0.05%	1.11%	0.60%	0.00%	0.09%	3.08%	0.81%	0.00%				149bp	281bp	47.0%	0.0%	94.5%	89.6%	96.0%	94.1M	26.7%	96.8%	24178.8Mb	196.0M	54.2%	98.0%	60.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_40_1																											141.2bp	95.0%	93.2M																74.1%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_40_2																																													73.0%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_40_trimmed_1																																													74.2%	54%	127bp	137bp	18%	98.0M	74.2%	54%	127bp	137bp	18%	98.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_40_trimmed_2																																													74.1%	54%	127bp	137bp	18%	98.0M	74.1%	54%	127bp	137bp	18%	98.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_41	196492678	0.01	137157235	0.30	1	0	0.97	251.12	63.00	1	0	0.000	9999000000	275220566	No	0.00%	149.7bp	136.0bp	0.06%	1.36%	0.71%	0.00%	0.10%	3.76%	0.94%	0.00%				179bp	439bp	30.4%	0.0%	95.6%	90.1%	96.1%	94.4M	15.7%	96.8%	24636.4Mb	196.5M	53.6%	98.2%	53.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_41_1																											149.7bp	95.8%	94.1M																72.0%	52%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_41_2																																													71.9%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_41_trimmed_1																																													72.0%	53%	129bp	142bp	18%	98.2M	72.0%	53%	129bp	142bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_41_trimmed_2																																													72.8%	53%	130bp	142bp	18%	98.2M	72.8%	53%	130bp	142bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_42	196178944	0.01	122498064	0.38	1	0	0.97	213.58	53.00	1	0	0.000	9999000000	184633609	No	0.00%	144.0bp	131.0bp	0.05%	1.30%	0.69%	0.00%	0.09%	3.59%	0.91%	0.00%				161bp	359bp	37.8%	0.0%	95.4%	89.8%	96.1%	94.2M	19.7%	96.8%	24260.9Mb	196.2M	53.9%	98.1%	57.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_42_1																											144.0bp	95.7%	93.9M																73.1%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_42_2																																													72.2%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_42_trimmed_1																																													73.2%	53%	128bp	137bp	18%	98.1M	73.2%	53%	128bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_42_trimmed_2																																													73.2%	54%	128bp	137bp	18%	98.1M	73.2%	54%	128bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_43	196247690	0.01	111940384	0.43	1	0	0.97	185.96	47.00	1	0	0.000	9999000000	140701202	No	0.00%	139.8bp	128.0bp	0.05%	1.27%	0.66%	0.00%	0.09%	3.49%	0.88%	0.00%				149bp	304bp	43.2%	0.0%	95.0%	89.7%	96.0%	94.2M	23.5%	96.9%	23894.7Mb	196.2M	53.7%	98.1%	61.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_43_1																											139.8bp	95.4%	93.6M																74.5%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_43_2																																													73.2%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_43_trimmed_1																																													74.5%	53%	126bp	132bp	18%	98.1M	74.5%	53%	126bp	132bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_43_trimmed_2																																													74.3%	53%	126bp	132bp	18%	98.1M	74.3%	53%	126bp	132bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_44	196132664	0.01	112291005	0.43	1	0	0.97	186.31	48.00	1	0	0.000	9999000000	148452364	No	0.00%	141.4bp	130.0bp	0.05%	1.20%	0.63%	0.00%	0.09%	3.33%	0.84%	0.00%				150bp	302bp	43.0%	0.0%	94.8%	89.8%	96.0%	94.2M	23.8%	96.8%	24066.0Mb	196.1M	53.7%	98.1%	60.5%
FFPE_V4_0001_RNA_0005_23KMKGLT4_44_1																											141.4bp	95.3%	93.4M																73.8%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_44_2																																													72.9%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_44_trimmed_1																																													73.9%	53%	127bp	137bp	18%	98.1M	73.9%	53%	127bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_44_trimmed_2																																													74.0%	53%	127bp	137bp	18%	98.1M	74.0%	53%	127bp	137bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_45	196261194	0.01	107299881	0.45	1	0	0.97	172.69	44.00	1	0	0.000	9990000000	133052030	No	0.00%	138.0bp	127.0bp	0.05%	1.20%	0.63%	0.00%	0.09%	3.30%	0.84%	0.00%				144bp	273bp	45.6%	0.0%	94.5%	89.4%	95.9%	94.1M	23.5%	96.7%	23746.5Mb	196.3M	53.8%	98.1%	62.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_45_1																											138.0bp	94.9%	93.2M																74.3%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_45_2																																													73.2%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_45_trimmed_1																																													74.4%	53%	125bp	132bp	18%	98.1M	74.4%	53%	125bp	132bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_45_trimmed_2																																													74.3%	54%	125bp	132bp	18%	98.1M	74.3%	54%	125bp	132bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_46	195886336	0.01	107552667	0.45	1	0	0.97	172.16	43.00	1	0	0.000	9999000000	127236274	No	0.00%	136.3bp	126.0bp	0.05%	1.18%	0.62%	0.00%	0.08%	3.26%	0.84%	0.00%				142bp	263bp	45.4%	0.0%	94.6%	88.9%	95.8%	93.8M	22.9%	96.7%	23578.3Mb	195.9M	54.3%	97.9%	63.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_46_1																											136.3bp	95.0%	93.0M																73.7%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_46_2																																													72.7%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_46_trimmed_1																																													73.8%	54%	124bp	132bp	18%	97.9M	73.8%	54%	124bp	132bp	18%	97.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_46_trimmed_2																																													73.9%	54%	125bp	132bp	18%	97.9M	73.9%	54%	125bp	132bp	18%	97.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_47	195705450	0.01	107730332	0.45	1	0	0.97	173.41	44.00	1	0	0.000	9999000000	127930904	No	0.00%	136.5bp	127.0bp	0.05%	1.17%	0.62%	0.00%	0.09%	3.24%	0.84%	0.00%				144bp	269bp	45.2%	0.0%	94.4%	89.2%	95.9%	93.8M	23.9%	96.7%	23750.4Mb	195.7M	54.0%	97.9%	62.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_47_1																											136.5bp	95.0%	92.9M																74.2%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_47_2																																													72.6%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_47_trimmed_1																																													74.3%	53%	125bp	132bp	18%	97.9M	74.3%	53%	125bp	132bp	18%	97.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_47_trimmed_2																																													73.8%	54%	126bp	132bp	18%	97.9M	73.8%	54%	126bp	132bp	18%	97.9M
FFPE_V4_0001_RNA_0005_23KMKGLT4_48	195658818	0.01	110280072	0.44	1	0	0.97	177.82	45.00	1	0	0.000	9990000000	136409453	No	0.00%	138.0bp	127.0bp	0.04%	1.17%	0.62%	0.00%	0.08%	3.23%	0.83%	0.00%				144bp	266bp	43.9%	0.0%	94.4%	88.7%	95.8%	93.7M	24.3%	96.7%	23667.2Mb	195.7M	54.4%	97.8%	62.6%
FFPE_V4_0001_RNA_0005_23KMKGLT4_48_1																											138.0bp	94.9%	92.8M																73.3%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_48_2																																													72.2%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_48_trimmed_1																																													73.3%	54%	125bp	132bp	18%	97.8M	73.3%	54%	125bp	132bp	18%	97.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_48_trimmed_2																																													73.3%	54%	125bp	132bp	18%	97.8M	73.3%	54%	125bp	132bp	18%	97.8M
FFPE_V4_0001_RNA_0005_23KMKGLT4_4_1																											137.8bp	95.2%	93.5M																71.2%	55%	151bp	151bp	18%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_4_2																																													70.5%	55%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_4_trimmed_1																																													71.3%	55%	125bp	132bp	9%	98.2M	71.3%	55%	125bp	132bp	9%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_4_trimmed_2																																													71.4%	56%	125bp	132bp	18%	98.2M	71.4%	56%	125bp	132bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_5	196561640	0.01	130971848	0.33	1	0	0.97	220.56	55.00	1	0	0.000	9999000000	230540735	No	0.00%	139.9bp	129.0bp	0.04%	1.21%	0.65%	0.00%	0.08%	3.30%	0.86%	0.00%				147bp	276bp	33.6%	0.0%	94.9%	88.7%	95.7%	94.1M	16.4%	96.8%	24005.8Mb	196.6M	55.5%	98.3%	61.4%
FFPE_V4_0001_RNA_0005_23KMKGLT4_5_1																											139.9bp	95.2%	93.6M																70.8%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_5_2																																													70.3%	55%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_5_trimmed_1																																													70.9%	55%	126bp	132bp	9%	98.3M	70.9%	55%	126bp	132bp	9%	98.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_5_trimmed_2																																													71.1%	55%	126bp	132bp	18%	98.3M	71.1%	55%	126bp	132bp	18%	98.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_6	196503730	0.01	132357441	0.33	1	0	0.97	222.16	58.00	1	0	0.000	9999000000	243315681	No	0.00%	139.4bp	129.0bp	0.05%	1.20%	0.63%	0.00%	0.08%	3.31%	0.84%	0.00%				146bp	275bp	32.9%	0.0%	94.7%	89.2%	95.8%	94.1M	16.9%	96.7%	23972.6Mb	196.5M	54.6%	98.3%	61.8%
FFPE_V4_0001_RNA_0005_23KMKGLT4_6_1																											139.4bp	95.1%	93.4M																69.5%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_6_2																																													69.4%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_6_trimmed_1																																													69.5%	54%	126bp	132bp	18%	98.3M	69.5%	54%	126bp	132bp	18%	98.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_6_trimmed_2																																													70.4%	54%	126bp	132bp	18%	98.3M	70.4%	54%	126bp	132bp	18%	98.3M
FFPE_V4_0001_RNA_0005_23KMKGLT4_7	196426352	0.01	134049702	0.32	1	0	0.97	223.84	59.00	1	0	0.000	9999000000	256991988	No	0.00%	137.7bp	128.0bp	0.05%	1.22%	0.63%	0.00%	0.09%	3.34%	0.85%	0.00%				145bp	270bp	32.0%	0.0%	94.7%	89.0%	95.8%	94.0M	15.6%	96.7%	23865.4Mb	196.4M	54.6%	98.2%	62.6%
FFPE_V4_0001_RNA_0005_23KMKGLT4_7_1																											137.7bp	95.0%	93.3M																68.7%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_7_2																																													69.2%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_7_trimmed_1																																													68.8%	54%	126bp	132bp	18%	98.2M	68.8%	54%	126bp	132bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_7_trimmed_2																																													70.2%	54%	126bp	132bp	18%	98.2M	70.2%	54%	126bp	132bp	18%	98.2M
FFPE_V4_0001_RNA_0005_23KMKGLT4_8	196271668	0.01	130490868	0.34	1	0	0.97	214.94	56.00	1	0	0.000	9990000000	235202503	No	0.00%	135.8bp	126.0bp	0.05%	1.19%	0.63%	0.00%	0.10%	3.27%	0.84%	0.00%				141bp	258bp	33.7%	0.0%	94.8%	88.9%	95.7%	93.9M	16.2%	96.8%	23665.1Mb	196.3M	54.4%	98.1%	63.7%
FFPE_V4_0001_RNA_0005_23KMKGLT4_8_1																											135.8bp	95.2%	93.4M																69.7%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_8_2																																													69.3%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_8_trimmed_1																																													69.8%	54%	125bp	132bp	18%	98.1M	69.8%	54%	125bp	132bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_8_trimmed_2																																													70.3%	54%	125bp	132bp	18%	98.1M	70.3%	54%	125bp	132bp	18%	98.1M
FFPE_V4_0001_RNA_0005_23KMKGLT4_9	196747578	0.01	146651437	0.25	1	0	0.97	272.46	69.00	1	0	0.000	9990000000	379954105	No	0.00%	150.5bp	137.0bp	0.06%	1.37%	0.71%	0.00%	0.10%	3.79%	0.94%	0.00%				181bp	445bp	25.6%	0.0%	95.9%	90.1%	96.1%	94.5M	12.8%	96.8%	24829.6Mb	196.7M	53.9%	98.4%	53.3%
FFPE_V4_0001_RNA_0005_23KMKGLT4_9_1																											150.5bp	96.0%	94.4M																70.3%	53%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_9_2																																													70.1%	54%	151bp	151bp	27%	100.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_9_trimmed_1																																													70.4%	53%	130bp	147bp	18%	98.4M	70.4%	53%	130bp	147bp	18%	98.4M
FFPE_V4_0001_RNA_0005_23KMKGLT4_9_trimmed_2																																													71.0%	54%	130bp	147bp	18%	98.4M	71.0%	54%	130bp	147bp	18%	98.4M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	Custom content: SeqTools	Reads	SeqTools Reads	`reads`	None
\|\|	Custom content: SeqTools	Frac Unmapped	SeqTools Frac Unmapped	`frac_unmapped`	None
\|\|	Custom content: SeqTools	Unique Reads	SeqTools Unique Reads	`unique_reads`	None
\|\|	Custom content: SeqTools	Frac Dupes	SeqTools Frac Dupes	`frac_dupes`	None
\|\|	Custom content: SeqTools	Frac Reads On Target	SeqTools Frac Reads On Target	`frac_reads_on_target`	None
\|\|	Custom content: SeqTools	Frac Reads Off Target	SeqTools Frac Reads Off Target	`frac_reads_off_target`	None
\|\|	Custom content: SeqTools	N Q30	SeqTools N Q30	`n_q30`	None
\|\|	Custom content: SeqTools	Mean Depth	SeqTools Mean Depth	`mean_depth`	None
\|\|	Custom content: SeqTools	Q50 Depth	SeqTools Q50 Depth	`q50_depth`	None
\|\|	Custom content: SeqTools	Frac Bases Gt30X	SeqTools Frac Bases Gt30X	`frac_bases_gt30x`	None
\|\|	Custom content: SeqTools	Frac Bases Gt100X	SeqTools Frac Bases Gt100X	`frac_bases_gt100x`	None
\|\|	Custom content: SeqTools	GC Bias	Ratio of high GC (63-100%) to low GC (0-43%) reads	`gc_bias`	None
\|\|	Custom content: Preseq	Total Reads	Total reads from preseq analysis	`total_reads`	None
\|\|	Custom content: Preseq	Expected Distinct	Expected distinct molecules at maximum sequencing depth	`expected_distinct`	None
\|\|	Custom content: RNA contamination	RNA contaminated	Whether the sample was classified as contaminated from VAF_p90	`is_contaminated`	None
\|\|	Custom content: RNA contamination	RNA contamination %	Estimated RNA contamination from VAF_p90; 0% for samples classified as clean	`contamination_pct`	None
\|\|	Custom content: Kallisto	Fragment Length Mean	Mean fragment length from kallisto fragment length distribution	`fragment_length_mean`	None
\|\|	Custom content: Kallisto	Fragment Length Median	Median fragment length from kallisto fragment length distribution	`fragment_length_median`	None
\|\|	Custom content: Expression QC	pct Mito est. counts	Percentage of estimated counts from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_est_counts`	None
\|\|	Custom content: Expression QC	pct Ribo est. counts	Percentage of estimated counts from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_est_counts`	None
\|\|	Custom content: Expression QC	pct Housekeeping est. counts	Percentage of estimated counts from housekeeping genes.	`pct_hk_est_counts`	None
\|\|	Custom content: Expression QC	pct Male est. counts	pct Male est. counts	`pct_male_est_counts`	None
\|\|	Custom content: Expression QC	pct Mito TPM	Percentage of TPM from mitochondrial genes; high values can indicate cell damage or stress.	`pct_mito_tpm`	None
\|\|	Custom content: Expression QC	pct Ribo TPM	Percentage of TPM from ribosomal genes; useful for assessing RNA quality and technical variation.	`pct_ribo_tpm`	None
\|\|	Custom content: Expression QC	pct Housekeeping TPM	Percentage of TPM from housekeeping genes.	`pct_hk_tpm`	None
\|\|	Custom content: Expression QC	pct Male TPM	pct Male TPM	`pct_male_tpm`	None
\|\|	Kallisto	Frag Length	Estimated average fragment length	`fragment_length`	None
\|\|	Kallisto	% Aligned	% processed reads that were pseudoaligned	`percent_aligned`	None
\|\|	Kallisto	M Aligned	Pseudoaligned reads (millions)	`pseudoaligned_reads`	read_count
\|\|	Picard: InsertSizeMetrics	Insert Size	Median Insert Size, all read orientations (bp)	`summed_median`	None
\|\|	Picard: InsertSizeMetrics	Mean Insert Size	Mean Insert Size, all read orientations (bp)	`summed_mean`	None
\|\|	Picard: Mark Duplicates	Duplication	Mark Duplicates - Percent Duplication	`PERCENT_DUPLICATION`	None
\|\|	Picard: RnaSeqMetrics	rRNA	Percent of aligned bases overlapping ribosomal RNA regions	`PCT_RIBOSOMAL_BASES`	None
\|\|	Picard: RnaSeqMetrics	mRNA	Percent of aligned bases overlapping UTRs and coding regions of mRNA transcripts	`PCT_MRNA_BASES`	None
\|\|	RSeQC	% Proper Pairs	% Reads mapped in proper pairs	`proper_pairs_percent`	None
\|\|	STAR	% Aligned	% Uniquely mapped reads	`uniquely_mapped_percent`	None
\|\|	STAR	M Aligned	Uniquely mapped reads (millions)	`uniquely_mapped`	read_count
\|\|	fastp	% Duplication	Duplication rate before filtering	`pct_duplication`	None
\|\|	fastp	% > Q30	Percentage of reads > Q30 after filtering	`after_filtering_q30_rate`	None
\|\|	fastp	Mb Q30 bases	Bases > Q30 after filtering (millions)	`after_filtering_q30_bases`	base_count
\|\|	fastp	M Reads After Filtering	Total reads after filtering (millions)	`filtering_result_passed_filter_reads`	read_count
\|\|	fastp	GC content	GC content after filtering	`after_filtering_gc_content`	None
\|\|	fastp	% PF	Percent reads passing filter	`pct_surviving`	None
\|\|	fastp	% Adapter	Percentage adapter-trimmed reads	`pct_adapter`	None
\|\|	FastQC (raw)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (raw)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (raw)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (raw)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (raw)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (raw)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count
\|\|	FastQC (trimmed)	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC (trimmed)	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC (trimmed)	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC (trimmed)	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC (trimmed)	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC (trimmed)	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Kallisto

Kallisto is a program for quantifying abundances of transcripts from RNA-Seq data.DOI: 10.1038/nbt.3519.

Created with MultiQC

Picard

Picard is a set of Java command line tools for manipulating high-throughput sequencing data.

Insert Size

Plot shows the number of reads at a given insert size. Reads with different orientations are summed.

Created with MultiQC

Mark Duplicates

Number of reads, categorised by duplication state. Pair counts are doubled - see help text for details.

The table in the Picard metrics file contains some columns referring read pairs and some referring to single reads.

To make the numbers in this plot sum correctly, values referring to pairs are doubled according to the scheme below:

READS_IN_DUPLICATE_PAIRS = 2 * READ_PAIR_DUPLICATES
READS_IN_UNIQUE_PAIRS = 2 * (READ_PAIRS_EXAMINED - READ_PAIR_DUPLICATES)
READS_IN_UNIQUE_UNPAIRED = UNPAIRED_READS_EXAMINED - UNPAIRED_READ_DUPLICATES
READS_IN_DUPLICATE_PAIRS_OPTICAL = 2 * READ_PAIR_OPTICAL_DUPLICATES
READS_IN_DUPLICATE_PAIRS_NONOPTICAL = READS_IN_DUPLICATE_PAIRS - READS_IN_DUPLICATE_PAIRS_OPTICAL
READS_IN_DUPLICATE_UNPAIRED = UNPAIRED_READ_DUPLICATES
READS_UNMAPPED = UNMAPPED_READS

Created with MultiQC

RnaSeqMetrics Assignment

Number of bases in primary alignments that align to regions in the reference genome.

Created with MultiQC

Gene Coverage

Created with MultiQC

Preseq

Preseq estimates the complexity of a library, showing how many additional unique reads are sequenced for increasing total read count. A shallow curve indicates complexity saturation. The dashed line shows a perfectly complex library where total reads = unique reads.DOI: 10.1038/nmeth.2375.

Complexity curve (molecule count)

Note that the x-axis is trimmed at the point where all the datasets show 80% of their maximum y-value, to avoid ridiculous scales.

Created with MultiQC

RSeQC

RSeQC package provides a number of useful modules that can comprehensively evaluate high throughput RNA-seq data.DOI: 10.1093/bioinformatics/bts356.

Read Distribution

Read Distribution calculates how mapped reads are distributed over genome features.

Created with MultiQC

Inner Distance

Inner Distance calculates the inner distance (or insert size) between two paired RNA reads. Note that this can be negative if fragments overlap.

Created with MultiQC

Read Duplication

read_duplication.py calculates how many alignment positions have a certain number of exact duplicates. Note - plot truncated at 500 occurrences and binned.

Created with MultiQC

Junction Annotation

Junction annotation compares detected splice junctions to a reference gene model. An RNA read can be spliced 2 or more times, each time is called a splicing event.

Created with MultiQC

Junction Saturation

Junction Saturation counts the number of known splicing junctions that are observed in each dataset. If sequencing depth is sufficient, all (annotated) splice junctions should be rediscovered, resulting in a curve that reaches a plateau. Missing low abundance splice junctions can affect downstream analysis.

Click a line to see the data side by side (as in the original RSeQC plot).

Created with MultiQC

Infer experiment

Infer experiment counts the percentage of reads and read pairs that match the strandedness of overlapping transcripts. It can be used to infer whether RNA-seq library preps are stranded (sense or antisense).

Created with MultiQC

Bam Stat

All numbers reported in millions.

Created with MultiQC

Showing ⁴⁸/₄₈ rows and ¹⁴/₁₄ columns.

Sample Name	Total records	QC failed	Duplicates	Non primary hit	Unmapped	Unique	Read-1	Read-2	+ve strand	-ve strand	Non-splice reads	Splice reads	Proper pairs	Different chrom
FFPE_V4_0001_RNA_0005_23KMKGLT4_1	220.1M	0.0M	0.0M	22.6M	1.8M	187.1M	93.6M	93.5M	93.6M	93.6M	100.2M	86.9M	186.7M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_10	211.4M	0.0M	0.0M	14.3M	1.1M	190.1M	95.1M	95.0M	95.1M	95.1M	98.2M	91.9M	189.6M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_11	211.4M	0.0M	0.0M	14.3M	1.2M	190.1M	95.1M	95.0M	95.0M	95.0M	99.8M	90.3M	189.5M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_12	211.8M	0.0M	0.0M	14.8M	1.2M	189.8M	94.9M	94.8M	94.9M	94.9M	102.3M	87.5M	189.2M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_13	211.6M	0.0M	0.0M	14.4M	1.2M	190.1M	95.1M	95.0M	95.1M	95.1M	102.2M	87.9M	189.6M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_14	210.6M	0.0M	0.0M	14.0M	1.3M	189.5M	94.8M	94.7M	94.7M	94.7M	105.1M	84.4M	189.0M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_15	211.1M	0.0M	0.0M	13.9M	1.2M	190.3M	95.2M	95.1M	95.2M	95.2M	102.7M	87.6M	189.8M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_16	211.6M	0.0M	0.0M	14.5M	1.3M	189.8M	94.9M	94.8M	94.9M	94.9M	104.5M	85.2M	189.2M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_17	211.3M	0.0M	0.0M	14.2M	1.2M	190.2M	95.2M	95.1M	95.1M	95.1M	95.6M	94.6M	189.6M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_18	210.8M	0.0M	0.0M	13.8M	1.2M	190.0M	95.1M	95.0M	95.0M	95.0M	99.0M	91.0M	189.5M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_19	211.7M	0.0M	0.0M	14.7M	1.2M	189.9M	95.0M	94.9M	94.9M	94.9M	100.6M	89.3M	189.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_2	216.5M	0.0M	0.0M	19.1M	1.5M	188.5M	94.2M	94.2M	94.2M	94.2M	103.0M	85.4M	188.0M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_20	211.7M	0.0M	0.0M	14.7M	1.3M	189.8M	94.9M	94.8M	94.9M	94.9M	102.7M	87.1M	189.2M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_21	211.2M	0.0M	0.0M	14.1M	1.2M	190.0M	95.1M	95.0M	95.0M	95.0M	102.8M	87.3M	189.5M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_22	211.8M	0.0M	0.0M	14.9M	1.3M	189.8M	94.9M	94.8M	94.9M	94.9M	103.6M	86.1M	189.2M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_23	211.6M	0.0M	0.0M	14.5M	1.2M	190.0M	95.1M	94.9M	95.0M	95.0M	102.3M	87.7M	189.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_24	211.9M	0.0M	0.0M	14.8M	1.2M	189.9M	95.0M	94.9M	95.0M	95.0M	104.1M	85.9M	189.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_25	210.6M	0.0M	0.0M	13.9M	1.1M	189.9M	95.0M	94.9M	95.0M	95.0M	96.3M	93.6M	189.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_26	210.3M	0.0M	0.0M	13.5M	1.2M	190.1M	95.1M	95.0M	95.0M	95.0M	97.2M	92.9M	189.5M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_27	211.8M	0.0M	0.0M	14.9M	1.1M	189.8M	95.0M	94.9M	94.9M	94.9M	99.9M	89.9M	189.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_28	211.3M	0.0M	0.0M	14.3M	1.2M	190.0M	95.1M	94.9M	95.0M	95.0M	101.5M	88.5M	189.5M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_29	211.0M	0.0M	0.0M	14.3M	1.2M	189.7M	94.9M	94.8M	94.9M	94.8M	103.0M	86.7M	189.2M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_3	214.8M	0.0M	0.0M	17.4M	1.4M	189.2M	94.6M	94.6M	94.6M	94.6M	104.2M	85.0M	188.7M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_30	212.1M	0.0M	0.0M	15.2M	1.2M	189.6M	94.8M	94.8M	94.8M	94.8M	104.3M	85.2M	189.1M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_31	210.8M	0.0M	0.0M	14.0M	1.2M	189.9M	95.0M	94.9M	95.0M	95.0M	103.2M	86.7M	189.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_32	212.0M	0.0M	0.0M	15.2M	1.2M	189.5M	94.8M	94.7M	94.8M	94.8M	104.2M	85.3M	189.0M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_33	211.5M	0.0M	0.0M	14.5M	1.1M	189.9M	95.0M	94.9M	95.0M	95.0M	97.2M	92.8M	189.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_34	210.9M	0.0M	0.0M	14.1M	1.1M	190.0M	95.0M	94.9M	95.0M	95.0M	98.2M	91.8M	189.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_35	211.2M	0.0M	0.0M	14.3M	1.2M	190.0M	95.0M	94.9M	95.0M	95.0M	101.1M	88.8M	189.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_36	211.4M	0.0M	0.0M	14.5M	1.2M	189.8M	94.9M	94.8M	94.9M	94.9M	103.1M	86.7M	189.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_37	211.6M	0.0M	0.0M	15.0M	1.2M	189.5M	94.8M	94.7M	94.7M	94.7M	104.6M	84.9M	189.0M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_38	211.2M	0.0M	0.0M	14.4M	1.2M	189.8M	94.9M	94.8M	94.9M	94.9M	104.8M	84.9M	189.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_39	211.5M	0.0M	0.0M	14.9M	1.2M	189.4M	94.8M	94.7M	94.7M	94.7M	104.0M	85.4M	188.9M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_4	213.6M	0.0M	0.0M	16.6M	1.4M	189.1M	94.6M	94.5M	94.6M	94.6M	105.2M	83.9M	188.6M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_40	211.1M	0.0M	0.0M	14.4M	1.2M	189.6M	94.8M	94.7M	94.8M	94.8M	104.3M	85.3M	189.1M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_41	210.7M	0.0M	0.0M	13.6M	1.1M	190.3M	95.2M	95.1M	95.2M	95.2M	96.4M	93.9M	189.8M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_42	210.8M	0.0M	0.0M	14.0M	1.1M	189.9M	95.0M	94.9M	95.0M	95.0M	99.2M	90.7M	189.4M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_43	211.0M	0.0M	0.0M	14.1M	1.2M	189.8M	95.0M	94.9M	94.9M	94.9M	102.2M	87.6M	189.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_44	210.7M	0.0M	0.0M	14.0M	1.2M	189.8M	95.0M	94.8M	94.9M	94.9M	102.6M	87.2M	189.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_45	211.5M	0.0M	0.0M	14.6M	1.2M	189.6M	94.9M	94.8M	94.8M	94.8M	104.7M	84.9M	189.2M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_46	212.2M	0.0M	0.0M	15.6M	1.3M	189.1M	94.6M	94.5M	94.5M	94.5M	105.3M	83.8M	188.6M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_47	211.3M	0.0M	0.0M	15.0M	1.3M	189.0M	94.6M	94.5M	94.5M	94.5M	104.6M	84.5M	188.5M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_48	212.3M	0.0M	0.0M	16.0M	1.3M	188.8M	94.4M	94.3M	94.4M	94.4M	105.2M	83.6M	188.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_5	213.2M	0.0M	0.0M	16.0M	1.3M	189.6M	94.8M	94.8M	94.8M	94.8M	104.8M	84.8M	189.1M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_6	212.2M	0.0M	0.0M	15.0M	1.3M	189.8M	94.9M	94.9M	94.9M	94.9M	104.7M	85.1M	189.3M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_7	212.4M	0.0M	0.0M	15.3M	1.3M	189.7M	94.9M	94.8M	94.8M	94.8M	105.0M	84.7M	189.1M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_8	212.6M	0.0M	0.0M	15.6M	1.3M	189.4M	94.8M	94.7M	94.7M	94.7M	105.9M	83.6M	188.9M	0.0M
FFPE_V4_0001_RNA_0005_23KMKGLT4_9	210.9M	0.0M	0.0M	13.5M	1.1M	190.7M	95.4M	95.3M	95.3M	95.3M	95.8M	94.8M	190.1M	0.0M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-rseqc_bam_stat

Sort	Column	Description	ID	Scale
\|\|	Total records	Total records	`total_records`	read_count
\|\|	QC failed	QC failed	`qc_failed`	read_count
\|\|	Duplicates	Optical/PCR duplicate	`optical_pcr_duplicate`	read_count
\|\|	Non primary hit	Non primary hit	`non_primary_hits`	read_count
\|\|	Unmapped	Unmapped reads	`unmapped_reads`	read_count
\|\|	Unique	mapq >= mapq_cut (unique)	`mapq_gte_mapq_cut_unique`	read_count
\|\|	Read-1	Read-1	`read_1`	read_count
\|\|	Read-2	Read-2	`read_2`	read_count
\|\|	+ve strand	Reads map to '+'	`reads_map_to_sense`	read_count
\|\|	-ve strand	Reads map to '-'	`reads_map_to_antisense`	read_count
\|\|	Non-splice reads	Non-splice reads	`non-splice_reads`	read_count
\|\|	Splice reads	Splice reads	`splice_reads`	read_count
\|\|	Proper pairs	Reads mapped in proper pairs	`reads_mapped_in_proper_pairs`	read_count
\|\|	Different chrom	Proper-paired reads map to different chrom	`proper-paired_reads_map_to_different_chrom`	read_count

STAR

STAR is an ultrafast universal RNA-seq aligner.DOI: 10.1093/bioinformatics/bts635.

Alignment Scores

Created with MultiQC

Gene Counts

Statistics from results generated using --quantMode GeneCounts. The three tabs show counts for unstranded RNA-seq, counts for the 1st read strand aligned with RNA and counts for the 2nd read strand aligned with RNA.

Created with MultiQC

fastp

fastp An ultra-fast all-in-one FASTQ preprocessor (QC, adapters, trimming, filtering, splitting...).DOI: 10.1093/bioinformatics/bty560.

Filtered Reads

Filtering statistics of sampled reads.

Created with MultiQC

Insert Sizes

Insert size estimation of sampled reads.

Created with MultiQC

Sequence Quality

Average sequencing quality over each base of all reads.

Created with MultiQC

GC Content

Average GC content over each base of all reads.

Created with MultiQC

N content

Average N content over each base of all reads.

Created with MultiQC

FastQC (raw)

FastQC (raw) This section of the report shows FastQC results before adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

192 samples had less than 1% of reads made up of overrepresented sequences

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ⁵/₅ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	96	27060205	0.1423%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAAGATCGACATCTAGT	1	142865	0.0008%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTGTACGGATCTGGG	1	112500	0.0006%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGACTCTCGATCTGGG	1	128759	0.0007%
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACATAGGTATCTAGT	1	100919	0.0005%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (raw)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (raw)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (raw)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Created with MultiQC

FastQC (trimmed)

FastQC (trimmed) This section of the report shows FastQC results after adapter trimming.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

96 samples had less than 1% of reads made up of overrepresented sequences

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ¹/₁ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG	48	10658868	0.1131%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: table-fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC (trimmed)	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC (trimmed)	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC (trimmed)	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Min:

Max:

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
AGAT_CONVERTSPGFF2TSV	agat	`1.2.0`
ARRIBA	arriba	`2.4.0`
ARRIBA_FILTER_SAME_GENE	awk	`filter same-gene (gene1==gene2)`
ARRIBA_VISUALISATION	arriba	`2.4.0`
CANCER_INTRONS_TO_VCF	python	`3.11.0`
CTATSPLICING_STARTOCANCERINTRONS	ctat-splicing	`0.0.3`
EXTRACT_VAF_FEATURES	extract_vaf_features	`1.0.0`
	python	`3.11.14`
FASTQC	fastqc	`0.12.1`
FASTQC_FOR_FASTP	fastqc	`0.12.1`
FUSIONINSPECTOR	STAR-Fusion	`1.12.0`
FUSIONREPORT	fusion_report	`2.1.5`
	fusion_report DB retrieval	`null`
GATK4_MARKDUPLICATES	gatk4	`4.4.0.0`
	samtools	`1.17`
GTF2BED	perl	`5.26.2`
KALLISTO_QUANT	kallisto	`0.51.1`
KALLISTO_TO_TX2GENE_QC	expression_qc_and_signatures	`1.0.0`
	python	`3.11.0`
NGSCheckMATE	ngscheckmate	`1.0.0`
PICARD_COLLECTINSERTSIZEMETRICS	picard	`3.1.0`
PICARD_COLLECTRNASEQMETRICS	picard	`null`
PREDICT_CONTAMINATION	predict_contamination	`1.0.0`
	python	`3.11.14`
PRESEQ_LCEXTRAP	preseq	`3.2.0`
PRESEQ_TO_MULTIQC	preseq_to_multiqc	`1.0.0`
	python	`3.11.14`
RSEQC_BAMSTAT	rseqc	`5.0.2`
RSEQC_INFEREXPERIMENT	rseqc	`5.0.2`
RSEQC_INNERDISTANCE	rseqc	`5.0.2`
RSEQC_JUNCTIONANNOTATION	rseqc	`5.0.2`
RSEQC_JUNCTIONSATURATION	rseqc	`5.0.2`
RSEQC_READDISTRIBUTION	rseqc	`5.0.2`
RSEQC_READDUPLICATION	rseqc	`5.0.2`
SAMTOOLS_INDEX_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_INDEX_FOR_STARFUSION	samtools	`1.17`
SAMTOOLS_INDEX_FOR_STARFUSION_CRAM	samtools	`1.17`
SAMTOOLS_SORT_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_VIEW_FOR_ARRIBA	samtools	`1.17`
SAMTOOLS_VIEW_FOR_STARFUSION	samtools	`1.17`
SEQTK_SAMPLE	seqtk	`1.4.post122`
SEQTOOL_TO_MULTIQC	python	`3.11.14`
	seqtool_to_multiqc	`1.0.0`
STARFUSION	STAR-Fusion	`1.12.0`
STARFUSION_FILTER	filter_starfusion_main.py	`1.0`
	numpy	`2.4.1`
	pandas	`3.0.0`
	pyyaml	`6.0.3`
STAR_FOR_ARRIBA	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
STAR_FOR_STARFUSION	gawk	`5.1.0`
	samtools	`1.16.1`
	star	`2.7.10a0`
VCF_COLLECT	HGNC DB retrieval	`2025-01-22/23:32`
	python	`3.11.0`
Workflow	Nextflow	`25.10.2`
	nf-core/rnafusion	`3.0.2`
fastp	fastp	`0.23.4`

nf-core/rnafusion Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.

Methods

Data was processed using nf-core/rnafusion v3.0.2 of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.10.2 (Di Tommaso et al., 2017) with the following command:

nextflow run /code/main.nf -output-dir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion_100M__5f1fa79--20260304-094520' --project-dir /Users/anaik/Documents/Altera/rnafusion -profile docker,eks,debugging -name dev_rna_exp0001R_5f1fa79 --input 's3://natera-platform-sandbox/pipeline-outputs/demux_outputs/20260123_LH00166_0229_B23KMKGLT4__497a58ff--20260130-204339/samplesheets/rnaseq_samplesheetdev_rna_exp0001.csv' --outdir 's3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion_100M__5f1fa79--20260304-094520' -resume c05ed138-5e9d-4e94-8884-8dbe287cc125

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnafusion Workflow Summary

- this information is collected when the pipeline is started.

Core Nextflow options

runName: dev_rna_exp0001R_5f1fa79
containerEngine: docker
launchDir: /code
workDir: /natera-rnd-pltf-dev-nextflow-scratch-01/work
projectDir: /code
userName: nextflow
profile: docker,eks,debugging
configFiles: N/A

Input/output options

input: s3://natera-platform-sandbox/pipeline-outputs/demux_outputs/20260123_LH00166_0229_B23KMKGLT4__497a58ff--20260130-204339/samplesheets/rnaseq_samplesheetdev_rna_exp0001.csv
outdir: s3://natera-platform-sandbox/pipeline-outputs/cgp_runs/nextflow/dev_rna_exp0001/B23KMKGLT4/nfcore_rnafusion_100M__5f1fa79--20260304-094520
strand: unknown
genomes_base: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38
read_length: 150
arriba: true
arriba_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/
arriba_ref_blacklist: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/blacklist_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_cytobands: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/cytobands_hg38_GRCh38_v2.4.0.tsv
arriba_ref_known_fusions: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/known_fusions_hg38_GRCh38_v2.4.0.tsv.gz
arriba_ref_protein_domains: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/arriba/protein_domains_hg38_GRCh38_v2.4.0.gff3
ensembl_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/
fusioncatcher_limitSjdbInsertNsj: 2000000
fusioncatcher_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusioncatcher/human_v102/
fusioninspector_limitSjdbInsertNsj: 1000000
fusionreport_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/fusion_report_db/
hgnc_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/hgnc_complete_set.txt
hgnc_date: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/hgnc/HGNC-DB-timestamp.txt
starfusion: true
starfusion_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/starfusion/ctat_genome_lib_build_dir/
starindex_ref: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/star/
tools_cutoff: 1

Read trimming options

fastp_trim: true
adapter_fasta: []

Alignment compression options

cram: starfusion,arriba

Reference genome options

genome: GRCh38
fasta: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa
fai: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.all.fa.fai
gtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.gtf
chrgtf: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf
transcript: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.cdna.all.fa.gz
refflat: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.chr.gtf.refflat
rrna_intervals: s3://natera-platform-sandbox/pipeline-resources/AIH/rna/GRCh38/ensembl/Homo_sapiens.GRCh38.102.interval_list

Toggle navigation v1.21

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Kallisto

Picard

Insert Size

Mark Duplicates Help

RnaSeqMetrics Assignment

Gene Coverage

Preseq

Complexity curve (molecule count)

RSeQC

Read Distribution

Inner Distance

Read Duplication

Junction Annotation

Junction Saturation

Infer experiment

Bam Stat

Table-Rseqc Bam Stat: Columns

STAR

Alignment Scores

Gene Counts

fastp

Filtered Reads

Insert Sizes

Sequence Quality

GC Content

N content

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

nf-core/rnafusion Methods Description

Methods

References

Notes:

nf-core/rnafusion Workflow Summary

v1.21

Highlight Samples

Rename Samples

Show / Hide Samples

Mark Duplicates

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks