Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14841176570(98.2859%)
Q30 bases: 14408672555(95.4217%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14789645431(97.9447%)
Q30 bases: 14204141055(94.0672%)

Read1 after filtering:
total reads: 97597871
total bases: 12715516736
Q20 bases: 12661563233(99.5757%)
Q30 bases: 12458936573(97.9821%)

Read2 after filtering:
total reads: 97597871
total bases: 12726704389
Q20 bases: 12634132438(99.2726%)
Q30 bases: 12358523306(97.107%)

Filtering result:
reads passed filter: 195195742
reads failed due to low quality: 2730150
reads failed due to too many N: 512092
reads failed due to too short: 1562016
reads with adapter trimmed: 107886568
bases trimmed due to adapters: 4100131573

Duplication rate: 30.2949%

Insert size peak (evaluated by paired-end reads): 118

JSON report: V4_0001_RNA_0005_23H5VFLT4_s28.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s28.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s28_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s28_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s28_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s28_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s28.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s28.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 208 seconds