Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14815838143(98.1181%)
Q30 bases: 14322946307(94.8539%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14743765335(97.6408%)
Q30 bases: 14095135972(93.3453%)

Read1 after filtering:
total reads: 97275510
total bases: 12109817027
Q20 bases: 12057288139(99.5662%)
Q30 bases: 11859740105(97.9349%)

Read2 after filtering:
total reads: 97275510
total bases: 12126761053
Q20 bases: 12033899895(99.2342%)
Q30 bases: 11763488246(97.0044%)

Filtering result:
reads passed filter: 194551020
reads failed due to low quality: 3211322
reads failed due to too many N: 451012
reads failed due to too short: 1786646
reads with adapter trimmed: 127096290
bases trimmed due to adapters: 5233570456

Duplication rate: 34.7775%

Insert size peak (evaluated by paired-end reads): 109

JSON report: GM24385_0001_RNA_0001_23H5VFLT4_s48.fastp.json
HTML report: GM24385_0001_RNA_0001_23H5VFLT4_s48.fastp.html

fastp --in1 GM24385_0001_RNA_0001_23H5VFLT4_s48_1.fastq.gz --in2 GM24385_0001_RNA_0001_23H5VFLT4_s48_2.fastq.gz --out1 GM24385_0001_RNA_0001_23H5VFLT4_s48_1.fastp.fastq.gz --out2 GM24385_0001_RNA_0001_23H5VFLT4_s48_2.fastp.fastq.gz --json GM24385_0001_RNA_0001_23H5VFLT4_s48.fastp.json --html GM24385_0001_RNA_0001_23H5VFLT4_s48.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 202 seconds