Detecting adapter sequence for read1...
>Illumina TruSeq Adapter Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...
>Illumina TruSeq Adapter Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Read1 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14799855757(98.0123%)
Q30 bases: 14323508491(94.8577%)

Read2 before filtering:
total reads: 100000000
total bases: 15100000000
Q20 bases: 14756784713(97.7271%)
Q30 bases: 14118013856(93.4968%)

Read1 after filtering:
total reads: 97070335
total bases: 12322383970
Q20 bases: 12269438545(99.5703%)
Q30 bases: 12072438686(97.9716%)

Read2 after filtering:
total reads: 97070335
total bases: 12337205776
Q20 bases: 12241933088(99.2278%)
Q30 bases: 11966730842(96.9971%)

Filtering result:
reads passed filter: 194140670
reads failed due to low quality: 3119258
reads failed due to too many N: 470568
reads failed due to too short: 2269504
reads with adapter trimmed: 119011833
bases trimmed due to adapters: 4748837607

Duplication rate: 30.7397%

Insert size peak (evaluated by paired-end reads): 118

JSON report: V4_0001_RNA_0005_23H5VFLT4_s38.fastp.json
HTML report: V4_0001_RNA_0005_23H5VFLT4_s38.fastp.html

fastp --in1 V4_0001_RNA_0005_23H5VFLT4_s38_1.fastq.gz --in2 V4_0001_RNA_0005_23H5VFLT4_s38_2.fastq.gz --out1 V4_0001_RNA_0005_23H5VFLT4_s38_1.fastp.fastq.gz --out2 V4_0001_RNA_0005_23H5VFLT4_s38_2.fastp.fastq.gz --json V4_0001_RNA_0005_23H5VFLT4_s38.fastp.json --html V4_0001_RNA_0005_23H5VFLT4_s38.fastp.html --thread 12 --detect_adapter_for_pe 
fastp v0.23.4, time used: 172 seconds